Journal of Threatened Taxa | www.threatenedtaxa.org | 26 February 2025 | 17(2): 26538–26546

ISSN 0974-7907 (Online) | ISSN 0974-7893 (Print)

https://doi.org/10.11609/jott.9475.17.2.26538-26546

#9475 | Received 01 November 2024 | Final received 26 January 2025 | Finally accepted 09 February 2025

A report on Conidae (Gastropoda) from the Karnataka coast – distribution and shell morphometry

B.S. Chandan¹, R. Shyama Prasad Rao²& Mohammed S. Mustak³

^1,3Molecular and Genetics Lab, Department of Applied Zoology, Mangalore University, Mangalagangotri, Mangaluru,

Karnataka 574199, India.

²Center for Bioinformatics, NITTE deemed to be University, Mangaluru, Karnataka 575018, India.

¹chandugowda.sinu@gmail.com, ²drrsprao@gmail.com, ³msmustak@gmail.com (corresponding author)

Editor: J. Benjamin Franklin, Bombay Natural History Society, Mumbai, India. Date of publication: 26 February 2025 (online & print)

Citation: Chandan, B.S., R.S.P. Rao & M.S. Mustak (2025). A report on Conidae (Gastropoda) from the Karnataka coast – distribution and shell morphometry. Journal of Threatened Taxa 17(2): 26538–26546. https://doi.org/10.11609/jott.9475.17.2.26538-26546

Copyright: © Chandan et al. 2025. Creative Commons Attribution 4.0 International License. JoTT allows unrestricted use, reproduction, and distribution of this article in any medium by providing adequate credit to the author(s) and the source of publication.

Funding: This work did not receive any specific funding.

Competing interests: The authors declare no competing interests.

Statement of ethics: The work is in compliance with ethical standards. No animal ethics and bio-safety clearances were necessary.

Data availability: The data used in this work are available publicly as given in the tables and supplemental.

Author details: B.s. Chandan, hold’s a master degree in Zoology and currectly pursunig PhD in Department of Applied Zoology, Mangalore University. Passonate about wildlife ecology and conservation. Dr.r. Shyama Prasad Rao, faculty at Center for Bioinformatics, NITTE University, Mangaluru, Karnataka. His area of interest are bioinformatics, computational biology, data analysis. Dr.mohammed S. Mustak, professor, Department of Applied Zoology, Mangalore University, Mangalagangothri, Kartanataka. He is interested in the biodiversity of the cone snail (Mollusca: Conidae) and Lepidoptera diversity in Western Ghats and Lakshadweep archipelago.

Author contributions: BSC and MSM planned the work. BSC collected the data. BSC and RSPR analysed the data. BSC drafted the paper and RSPR revised the paper. All authors contributed intellectually, and edited/reviewed the manuscript. All authors have read and agreed to the published version of the manuscript.

Acknowledgements: Authors thank the Karnataka Forest Department for the permission to visit the study area and collect the samples. BSC thanks Mr. Akshay Jeere, Mr. A. Bharat Kumar, and the Department of Marine Biology, Karnataka University Post Graduate Centre, Karwar for support during the field survey. Authors thanks UGC-SAP II Department of Applied Zoology, Mangalore University for the facilities.

Abstract: Conidae are a diverse group of predatory marine gastropods known for their highly potent venom, which may hold potential for biomedical applications. This study presents findings from a survey of Conidae species inhabiting the coastal shorelines of Karnataka. Shell measurements and morphometric analyses were conducted on four species: Conus biliosus, C. inscriptus, C. milneedwardsi, and Conasprella dictator. Molecular phylogenetic analysis of C. biliosus was performed using the partial mitochondrial cytochrome oxidase subunit I (COI) gene sequence.

Keywords: Cone snails, Conasprella, Conus, Cytochrome oxidase subunit I (COI), marine biodiversity, shell morphometrics, venomous molluscs.

Introduction

The family Conidae Fleming, 1822 (Dutertre & Lewis 2023) is a widely-distributed species-rich group of marine gastropod molluscs (Rockel et al. 1995). Cone shells are found in all tropical and subtropical oceans, with the Indo-West-Pacific region having the greatest species diversity (Filmer 2001). Studies on the taxonomy and distribution of Conidae in India date back to the latter half of the 19^th century (Kohn 1978), and recently 76 of the 93 species known from India were reported from the collections of the Zoological Survey of India (Venkitesan et al. 2019). A total of 77 species of Conidae were documented from Indian waters (Kohn 1978). Regionally, 60 species were documented from Tamil Nadu (Franklin et al. 2009), 84 from the Gulf of Mannar and Lakshadweep Islands (Edward et al. 2022), and 46 from the Kerala coast (Ravinesh et al. 2022).

More than 50 species of cone shells have been identified by various researchers from the Andaman & Nicobar Islands (Rao 2003; Venkataraman et al. 2004; Franklin et al. 2013; Franklin & Apte 2021). A total of 78 cone snail species have been documented from the Lakshadweep archipelago (Smith 1894; Hornell 1921; Nagabhushanam & Rao 1972; Appukuttan et al. 1989; Rao & Rao 1991; Ravinesh & Kumar 2015; Edward et al. 2022). More recently, Ravinesh et al. (2018) recorded 49 species from Lakshadweep, including four newly reported species, three of which had not been previously recorded in India.

Until now, there have been no specific reports of Conus from the coast of Karnataka, India. This study presents the findings of a Conidae survey conducted in the year 2022–23 across several coastal regions of Karnataka. Field observations documented the regional distribution of four Conidae species, and shell morphometric analyses were carried out. Only one species was observed alive, and its molecular phylogenetic analysis was performed using the partial mitochondrial cytochrome oxidase subunit I (COI) gene sequence.

Materials and Methods

Sample collection

Field surveys were conducted on accessible beaches across three coastal districts of Karnataka: Dakshina Kannada, Udupi, and Uttara Kannada (Image 1A). Transect and trawl net surveys were carried out along the shorelines in various types of coastal marine habitats, including intertidal and subtidal sandy bottoms, shallow sandy areas, rocky shorelines, and algae-covered rocks. The frequency of each species in these habitats was recorded (Image 1B). The specimens were collected using the handpicking method. Live specimens of Conus biliosus (n = 2) were observed and collected exclusively from rocky shorelines and algae-covered rocks in Karwar, Uttara Kannada District. The identification of collected specimens was based on the shell morphology descriptions (Rocket et al. 1995). Foot tissue from the live specimen was preserved in 90% ethanol for molecular analysis.

Morphometric analysis

The collected shells were covered with algae, so for easier identification and measurement, they were cleaned using a mixture of commercial liquid bleach (“Rin”), containing nonylphenol ethoxylate, EDTA and sodium xylene sulfonate in water. To preserve the specimens, the surface of the shell was polished with mineral oil. Shell measurements were taken using Vernier Callipers (Kohn & Riggs 1975). The following variables were recorded: weight (W, in grams), shell length (SL), maximum diameter (MD), height of maximum diameter (HMD), aperture height (AH), aperture length (AL), aperture width (AW), height of penultimate whorl (HPW), and spire height (SH) (Fig. S1). All linear measurements were recorded in millimetres (mm).

DNA extraction and PCR amplification

The foot tissue of C. biliosus was used as the source of genetic material and DNA was isolated from 40 mg of tissue using the CTAB method (Doyle & Doyle 1987) yielding approximately 500 ng/µl in a total volume of 60 µl. The mitochondrial cytochrome oxidase subunit I (COI) gene was amplified using universal primers dgLCO: GGTCAACAAATCATAAAGAYATYGG and dgHCO: TAAACTTCAGGGTGACCAAARAAYCA (Folmer et al. 1994). Additionally, 12S1: GGCTTGGCGGTGTTTTAGAC and 12S3: GTGCACGTTTCAGAGCCCTA (Simon et al. 1991), and 16Sar: CGCCTGTTTACCAAAAACAT and 16Sbr: CCGGTCTGAACTCAGATCACGT (Palumbi 1996) primers were used to amplify 12S rRNA and 16S rRNA genes. PCR reactions were conducted in a total volume of 30µl, containing 3µl DNA, 1.5µl of each primer, 13.5µl of Takara master mix, 1.5 µl MgCl₂, and 9µl of PCR gradient water. The protocol began with initial amplification reaction that denatured at 94°C for 4 minutes, followed by 35 cycle denaturation for 40 seconds, annealing at 51°C for 40 seconds and extension at 72°C for 1 minute. A final extension step at 72°C for 5 minutes was included (Laxmilatha et al. 2021). The genomic DNA concentration and yield of PCR products were quantified using a Nano Drop spectrophotometer (Thermo Fisher Scientific Pvt. Ltd.) and assessed qualitatively using 0.8% agarose gel electrophoresis for DNA and 2% acrylamide gel electrophoresis for PCR products.

Phylogenetic analysis

The amplified PCR products were sequenced using the Sanger sequencing method (Barcode Biosciences). The resulting sequences were compared against the NCBI nr database using BLAST, and the top hits corresponding to C. biliosus were downloaded. Additionally, sequences of closely related species (C. shikamai) and other COI sequences were retrieved for use as an outgroup. Multiple sequence alignment was performed using MUSCLE, and a phylogenetic tree was constructed using the maximum likelihood (ML) method with the Kimura 2-parameter (K2P) model in MEGA7 software (Kumar et al. 2016). Bootstrap analysis was conducted with 1,000 replicates to assess the tree’s robustness.

Data/Statistical analysis:

The morphometric measurements were recorded in a Microsoft Excel spreadsheet and summarized as mean (±standard deviation) along with minimum-maximum values. A Spearman’s rank correlation coefficient matrix of the morphometric variables was generated using the R corrplot package (Wei & Simko 2021), and scatter plots of morphometric variables (Raup 1961; Kohn & Riggs 1975) were created in Microsoft Excel. Principal component analysis (PCA) was then performed using the R ggplot2 package (Wickham 2016).

Results

Distribution

Four species were recorded: Conus biliosus, C. inscriptus, C. milneedwardsi, and Conasprella dictator; only C. biliosus was sampled alive. Altogether, 27 shells, including two live specimens were collected. Conus milneedwardsi is listed under Schedule I of the Indian Wildlife (Protection) Act, 1972, Part G: Mollusca (Ravinesh et al. 2019; Samuel et al. 2021).

Based on the sampling data (Image 2A–D), Conus biliosus, C. inscriptus, and Conasprella dictator were observed in the Uttara Kannada and Dakshina Kannada districts, while C. milneedwardsi was recorded only in the Udupi District. Sampling of cone shells included several marine habitats. Conus biliosus was found in shallow water sandy bottoms and rocky habitats (Image 1B, 2N–Q) with live specimens collected from algae-covered rocks. Conasprella dictator and Conus inscriptus shells were found in rocky shoreline areas and shallow muddy bottoms (Image 1B), In contrast, C. milneedwardsi shells were collected by trawling in shallow muddy bottoms.

Family: Conidae Fleming, 1822

Genus: Conus Linnaeus, 1758

Conus biliosus (Röding, 1798)

Method of collection: Handpicking.

Condition: Live specimens (n = 2) and shells (n = 11).

Habitat: Rocky shore and algae-covered rocks.

Description (Image 2A, 2E–M): Shell length approximately ranges from 20 mm to 40 mm, the body is covered with low, wavy spiral ridges that run from shell base to shoulder and spiral growth ridges are frequently visible, but in some shells they are smooth. We observed this species with different shades (Image 2E–M) of orange, brown, brown-black, and pale brown (juvenile).

Conus inscriptus Reeve, 1843

Method of collection: Trawl bycatch.

Condition: Shells (n = 6).

Habitat: Shallow to subtidal sandy bottom.

Description (Image 2B): Shell length approximately ranges 40–55 mm. Shells are solid with a monotonous finish in a pale brown colour. Anteriorly, spiral grooves present – grooves are wide and contain spiral threads. In the sub-shoulder, bands are usually less noticeable than anterior bands.

Conus milneedwardsi Jousseaume, 1894

Method of collection: Trawl bycatch.

Condition: Shells (n = 3).

Habitat: Subtidal sandy bottoms.

Description (Image 2C): Shell length approximately ranges 86–136 mm. Shells are reddish-white or brownish-white with prominent reticulated patches and spiral bands.

Genus: Conasprella Thiele, 1929

Conasprella dictator (Melvill, 1898)

Method of collection: Handpicking and trawl bycatch.

Condition: Shells (n = 5).

Habitat: Shallow sandy bottoms.

Description (Image 2D): Shell length approximately ranges 25–35 mm. Shell is brownish-cream color, surrounded by distinct, dark-brown to reddish-brown bands, which are particularly prominent on the body whorl.

Morphometric analysis

The morphometric data for C. biliosus (n = 13), Conasprella dictator (n = 5), C. inscriptus (n = 6), and C. milneedwardsi (n = 3) is given in Table 1.

The Spearman’s rank correlation coefficient matrix of the morphometric variables indicated that all variables were positively correlated (Figure 1A), with correlation coefficients ranging from ρ = 0.38 to ρ = 0.99. The scatter plots of morphometric variables against shell length are shown in Figure 1B–I. The variables such as HMD (R²=0.994) and AL (R² = 0.987) exhibited excellent predictability in relation to shell length. Some variables, such as AW and HPW appeared to be more species-specific as C. milneedwardsi samples deviated from the general trend. HPW demonstrated the lowest predictability with respect to shell length among and within species.

A PCA (Figure 2) biplot of morphometric measurements explained 75.6% of the variance in PC1 and 15.5% in PC2. The samples from all four species formed distinct clusters, though the Conasprella dictator cluster overlapped with that of C. biliosus. As indicated by the lower variability of morphometric measurements (Table 1), Conasprella dictator was less spread compared to the other species in the PCA biplot. The variables projected onto the biplot revealed that SL, MD, and other factors primarily contributed to PC1, as evident by the spread of long-shelled C. milneedwardsi along PC1. The variables HPW, AW and SH primarily contributed to PC2.

Phylogeny of C. biliosus

The mitochondrial COI sequences from two C. biliosus samples were obtained and submitted to NCBI (supplemental information). The phylogenetic tree based on these COI sequences revealed that C. biliosus samples (PQ390234 and PQ392002) from Karnataka were distinct, but clustered within the same clade of other C. biliosus (KJ549870.1 and KJ550138.1) from Indo-West-Pacific region (Puillandre et al. 2014) (Figure 3). The C. shikamai and other species formed a clear outgroup. Since COI sequences were found and used widely for cone snail databases, 12S rRNA and 16S rRNA sequences were not included in the analysis.

Discussion

This study documents four species of cone snails: C. biliosus, C. inscriptus, C. milneedwardsi, and Conasprella dictator from the Karnataka coast. While Conidae species generally share a similar shell shape (Rockel et al. 1995), morphometric measurements are widely used as distinguishing features between species. The ranges of values observed in this study are consistent with previous records of morphometric measurements for cone shells of the corresponding species from the Indo-Pacific region (Rockel et al. 1995), Lakshadweep (Ravinesh et al. 2018), Tamil Nadu (Venkitesan et al. 2019), and Kerala (Ravinesh et al. 2022).

The phylogenetic analysis based on mitochondrial COI sequences of live C. biliosus specimens collected in this study placed them in a monophyletic group with C. biliosus meyeri, a southern subspecies found in Indian marine habitats (Puillandre et al. 2014).

This pilot study on the previously unexplored Karnataka coast may inspire researchers to conduct more intensive surveys and acquire accurate data on habitat and distribution of cone snails of the Karnataka coast.

Table 1. The morphometric measurements of the collected cone shells.

Variables

C. biliosus

(n = 13)

Mean (±SD)

Min–Max

Conasprella dictator

(n = 5)

Mean (±SD)

Min–Max

C. inscriptus

(n = 6)

Mean (±SD)

Min–Max

C. milneedwardsi

(n = 3)

Mean (±SD)

Min–Max

4.2 (2.3)

1.3–8.4

2.1 (0.7)

1.4–3.3

10.7 (3.6)

6.8–15.3

41.1 (21.8)

17.7–60.8

28.2 (7.2)

19.1–41.2

29.1 (4.2)

25–35.5

48.8 (5.5)

41.9–54.6

114.7 (25.8)

86–136

17.2 (3.7)

11.2–22.6

13.6 (1.9)

12.1–16.9

24.2 (3.4)

20.3–27.8

38.0 (12.5)

24–48

HMD

19.8 (6.0)

12.7–32.3

20.1 (2.8)

17.8–24.7

36.3 (4.9)

29.2–41.2

72.4 (16.0)

54.1–84

25.5 (6.4)

16.7–35.5

23.1 (2.5)

21–27

39.3 (4.8)

34.8–45.8

76.7 (14.4)

60.1–86

23.0 (6.3)

14.1–32

21.8 (2.6)

19.7–26

39.4 (5.6)

33–45.3

74.7 (16.3)

55.9–85.2

3.2 (1.0)

1.8–4.9

3.0 (1.1)

1.9–4.4

5.0 (0.7)

4.1–5.8

4.2 (0.4)

3.8–4.5

HPW

1.4 (0.4)

0.7–2.3

1.3 (0.4)

0.6–1.9

3.7 (1.4)

2.2–6.0

2.2 (0.2)

2.0–2.3

3.5 (1.1)

2.5–6.1

13.8 (6.3)

6.7–20.0

8.7 (1.0)

7.2–9.9

31.7 (4.1)

27.2–35

For figures & images - - click here for full PDF

References

Appukuttan, K.K., A. Chellam & A.K. Ramdoss (1989). Molluscan resources. In: Suseelan, C. (Ed.), Marine living resources of the union territory of Lakshadweep: An indicative survey with suggestions for development. CMFRI Bulletin 43: 77–92.

Doyle, J.J. & J.L. Doyle (1987). A rapid DNA isolation procedure for small quantities of fresh leaf tissue. Phytochemical Bulletin 19: 11–15.

Dutertre, S. & R.J. Lewis (2013). Cone snail biology, bioprospecting and conservation, ffhal-02306901f, pp. 1–15. In: Hämäläinen, E.M. & Sofia Järvinen (eds.). Snails: Biology, Ecology, and Conservation. Nova Science Publishers, New York.

Edward, J.K.P., R. Ravinesh & A.B. Kumar (2022). The molluscs of Gulf of Mannar, India and adjacent waters: A fully illustrated guide. Suganthi Devadason Marine Research Institute (SDMRI) & Department of Aquatic Biology & Fisheries, Thiruvananthapuram, Kerala, India.

Filmer, R.M. (2001). A catalogue of nomenclature and taxonomy in the living Conidae. Backhuys Publishers, Leiden, 388 pp.

Folmer, O., M. Black, W.R. Hoeh, R. Lutz & R.C. Vrijenhoek (1994). DNA primers for amplification of mitochondrial cytochrome c oxidase subunit I from diverse metazoan invertebrates. Molecular Marine Biology and Biotechnology 3: 294–299. https://doi.org/10.1016/1050-1738(94)90029-9

Franklin, J.B., K.A. Subramanian, S.A. Fernando & K.S. Krishnan (2009). Diversity and distribution of Conidae from the Tamil Nadu coast of India (Mollusca: Caenogastropoda: Conidae). Zootaxa 2250: 1–63. https://doi.org/10.11646/zootaxa.2250.1.1

Franklin, J.B., P. Venkateshwaran, N.V. Vinithkumar & R. Kirubagaran (2013). Four new records of Conidae (Mollusca: Caenogastropoda) from the Andaman Islands, India. Zootaxa 3635: 81–86. https://doi.org/10.11646/zootaxa.3635.1.8

Franklin, J.B. & D.A. Apte (2021). Three new distribution records of Conidae (Gastropoda: Neogastropoda: Conoidea) from the Andaman Islands, India. Journal of Threatened Taxa 13: 18378–18384. https://doi.org/10.11609/jott.6891.13.5.18378–18384

Hornell, J. (1921). Common molluscs of South India; Appendix molluscan fauna of the Laccadive islands. Madras Fisheries Bulletin 14: 213–215.

Kohn, A.J. & A.C. Riggs (1975). Morphometry of the Conus shell. Systematic Zoology 24: 346–359. https://doi.org/10.1093/sysbio/24.3.346

Kohn, A.J. (1978). The Conidae (Mollusca: Gastropoda) of India. Journal of Natural History 12: 295–335. https://doi.org/10.1080/00222937800770171

Kumar, S., G. Stecher & K. Tamura (2016). MEGA7: Molecular evolutionary genetics analysis version 7.0 for bigger datasets. Molecular Biology and Evolution 33: 1870–1874. https://doi.org/10.1093/molbev/msw054

Laxmilatha, P., S. Ameri, K.A. Labeeb, K.V. Chaitanya & V.N. Varma (2021). A new species of cone snail, Conus laccadivensis sp. nov.: (Gastropoda: Conidae) from the Islands of Lakshadweep Archipelago. Regional Studies in Marine Science 44: 101783. https://doi.org/10.1016/j.rsma.2021.101783

Nagabhushanam, A.K. & G.C. Rao (1972). An ecological survey of the marine fauna of Minicoy Atoll (Laccadive Archipelago, Arabian Sea). Mitteilungen Aus Dem Museum Für Naturkunde in Berlin. Zoologisches Museum Und Institut Für Spezielle Zoologie (Berlin) 48: 265–324. https://doi.org/10.1002/mmnz.19720480203

Palumbi, S.R. (1996). The polymerase chain reaction, pp. 205–247. In: Hillis, D.M., C. Moritz & B.K. Mable (eds.). Molecular Systematics, 2nd edition. Sinauer, Sunderland, Massachusetts.

Puillandre, N., P. Bouchet, Jr. T.F. Duda, Y.I. Kantor, A.V. Sysoev & C. Meyer (2014). Molecular phylogeny and evolution of the cone snails (Gastropoda, Conoidea). Molecular Phylogenetics and Evolution 78: 290–303. https://doi.org/10.1016/j.ympev.2014.05.023

Rao, K.V. & N.V. Rao (1991). Mollusca, pp. 273–362. In: Ghosh, A.K. & A. Kumar (eds.). State fauna series 2. Fauna of Lakshadweep. Zoological Survey of India.

Rao, N.V.S. (2003). Indian Sea Shells (Part 1). Polyplacophora and Gastropoda. Records of the Zoological Survey of India, Kolkata, 416 pp.

Raup, D.M. (1961). The geometry of coiling in gastropods. Proceedings of the National Academy of Sciences 47: 602–609. https://doi.org/10.1073/pnas.47.4.602

Ravinesh, R. & A.B. Kumar (2015). A checklist of the marine molluscs of Lakshadweep, India. Journal of Aquatic Biology & Fisheries 3: 15–55.

Ravinesh, R., A.B. Kumar & A.J. Kohn (2018). Conidae (Mollusca, Gastropoda) of Lakshadweep, India. Zootaxa 4441: 467–494. https://doi.org/10.11646/zootaxa.4441.3.3

Ravinesh, R., A.B. Kumar & V.D. Samuel (2019). Status of marine molluscs in illegal wildlife trade in India. TRAFFIC Post 30: 33–39.

Ravinesh, R., A.B. Kumar & P. Karnaver (2022). Diversity of Conidae (Caenogastropoda: Conoidea) from the Kerala Coast, India. Molluscan Research 42: 73–89. https://doi.org/10.1080/13235818.2022.2034080

Rockel, D., W. Korn & A.J. Kohn (1995). Manual of the living Conidae. Indo-Pacific region. Verlag Christa Hemmen, Wiesbaden 517 pp.

Samuel, D.V., R. Ravinesh, A.B. Kumar, K.P. Raghuram, R.K. Sundar & R.K. Thakur (2021). Protected molluscs (seashells) of India. TRAFFIC Identification Poster 11–12.

Simon, C., A. Franke & A. Martin (1991). The polymerase chain reaction: DNA extraction and amplification, pp. 329–355. In: Hewitt, G.M. (ed.). Molecular Techniques in Taxonomy. Springer, Berlin, Germany. https://doi.org/10.1007/978-3-642-83962-7_22

Smith, E.A. (1894). XLIV-Natural history notes from HM Indian marine survey steamer ‘Investigator,’ Commander CF Oldham, RN-Series II., No. 10. Report upon some Mollusca dredged in the Bay of Bengal and the Arabian Sea. Journal of Natural History 14: 157–174. https://doi.org/10.1080/00222939408677814

Venkataraman, K., R. Jeyabaskaran, K.P. Raghuram & J.R.B. Alfred (2004). Bibliography and checklist of corals and coral reef associated organisms of India. Records of the Zoological Survey of India 226: 1–468.

Venkitesan, R., S. Barua & M. Hafiz (2019). Contribution to the knowledge on Indian marine molluscs: Family Conidae. Records of the Zoological Survey of India 119: 165–184.

Wei, T. & V. Simko (2021). R package “Corrplot”: Visualization of a Correlation Matrix. The Comprehensive R Archive Network 26 pp. https://doi.org/10.1007/978-3-030-50889-1_45

Wickham, H. (2016). ggplot2: Elegant Graphics for Data Analysis. Springer, New York, 260 pp. https://doi.org/10.1007/978-3-319-24227-4