Journal of Threatened Taxa | www.threatenedtaxa.org | 26 November 2024 | 16(11): 26116–26123

ISSN 0974-7907 (Online) | ISSN 0974-7893 (Print)

https://doi.org/10.11609/jott.9368.16.11.26116-26123

#9368 | Received 05 September 2024 | Final received 05 October 2024 | Finally accepted 31 October 2024

DNA barcoding and distribution of Osteobrama peninsularis (Teleostei: Cyprinidae) in India

Boni Amin Laskar ^{1 ,} Asha Kiran Tudu ², Shibananda Rath ³ & Laishram Kosygin ⁴

¹ Zoological Survey of India, High Altitude Regional Centre, Saproon, Solan, Himachal Pradesh 173211, India.

^2,3,4 Zoological Survey of India, Freshwater Fish Section, 27 JL Nehru Road, Kolkata, West Bengal 700016, India.

¹ boniamin.laskar@gmail.com (corresponding author), ² kiran.asha31@gmail.com, ³ rathshibananda@gmail.com,⁴ lkzsi5@yahoo.com

Editor: Mandar Paingankar, Government Science College Gadchiroli, Maharashtra, India. Date of publication: 26 November 2024 (online & print)

Citation: Laskar, B.A., A.K. Tudu, S. Rath & L. Kosygin (2024). DNA barcoding and distribution of Osteobrama peninsularis (Teleostei: Cyprinidae) in India. Journal of Threatened Taxa 16(11): 26116–26123. https://doi.org/10.11609/jott.9368.16.11.26116-26123

Copyright: © Laskar et al. 2024. Creative Commons Attribution 4.0 International License. JoTT allows unrestricted use, reproduction, and distribution of this article in any medium by providing adequate credit to the author(s) and the source of publication.

Funding: The research is funded by the Core Funding of Zoological Survey of India (ZSI), Kolkata, Ministry of Environment, Forest and Climate Change (MoEF&CC), New Delhi.

Competing interests: The authors declare no competing interests.

Author details: Dr. Boni Amin Laskar is currently working as scientist-E in Zoological Survey of India. His field of research is molecular studies & taxonomy of freshwater fishes. He has over 23 years of research experience including field surveys throughout various Biogeographic zones in India, and published in several reputed journals. Asha Kiran Tudu is working as assistant zoologist in Zoological Survey of India. With over 15 years of experience in the field of freshwater fish taxonomy, she has described several new fish species and published in reputed journals. Shibananda Rath is currently working as scientist-C in Zoological Survey of India. With over 25 years of experience including field surveys and taxonomic studies, especially from the Himalayan and northeast Indian region, he has published in several reputed journals. He has described several new fish species and new records from India. Dr. Laishram Kosygin Singh is currently working as scientist-E in Zoological Survey of India. His field of specialization is taxonomy of freshwater fish. With over 25 years of experience in taxonomic research, he has described over 40 new fish species from India and Myanmar, and documented systematic checklist of fishes of India.

Author contributions: BAL & AKT did field surveys and collected the specimens. BAL, AKT & SR studied the morphology and meristics of the specimens for taxonomic identification. BAL generated the DNA data, and did the molecular analysis. BAL, AKT, SR & LK wrote the article. BAL & LK reviewed the article.

Acknowledgements: We would like to express our heartfelt gratitude to Dr. Dhriti Banerjee, Director of the Zoological Survey of India, for graciously granting us permission to undertake this important work.

Abstract: Osteobrama peninsularis has been reported in southern Indian drainages, particularly in the Krishna River drainage. This study provides new findings of O. peninsularis in two distant locations: the Kangsabati River (Suvarnarekha River drainage) in West Bengal and Wyra Lake (Godavari River drainage) in Telangana. This marks the first record of O. peninsularis in eastern India, specifically in West Bengal. The species can be distinguished from other Osteobrama members by its 28–31 branched anal-fin rays and 55–60 lateral line scales, along with other unique morphological features. Mitochondrial cytochrome oxidase C subunit I gene sequences from specimens collected in Suvarnarekha and Godavari River drainages cluster together in the phylogenetic analysis, indicating that the clade of O. peninsularis is distinct and maintains significant genetic distance from its congeners.

Keywords: Carp, genetic analysis, minnow, new record, peninsular India, range extension, ray-finned fish, taxonomy, West Bengal.

introduction

The genus Osteobrama includes several key food fish species in India, thriving in both lentic and lotic systems. The species in the genus Osteobrama (type species Cyprinus cotio Hamilton, 1822) are characterized by their laterally compressed bodies, elevated dorsum, absence of procumbent predorsal spines, rounded abdomens in front of the pelvic fins, keeled abdominal edges from the pelvic-fin origin to the vent, and long anal fins with more than 10 branched rays (Talwar & Jhingran 1991). Hamilton (1822) described the type species as having a row of “5–6 black spots below the fore part of the lateral line, around which is a bluish shining depression” (plate 207).

Sykes described two species, Rohtee vigorsii and R. ogilbii, from the Deccan region of India (Sykes 1838), categorizing them under the genus Rohtee, which he characterized by long dorsal and anal fins, a posteriorly serrated last undivided dorsal-fin ray, and minute scales. Bleeker (1863) designated R. ogilbii as the type species of the genus, a classification upheld in later taxonomic work (Tilak & Husain 1989). The placement of species within the genera Osteobrama and Rohtee has been addressed by Jordan (1919), Hora (1921), and Mukerji (1934). Hora (1937) distinguished R. ogilbii from species now classified as Osteobrama by its unique procumbent predorsal spine and the long anal fin with 13 to 14 branched rays, Consequently, Rohtee is now recognized as valid with R. ogilbii as its sole species, while Osteobrama currently includes 10 valid species (Laskar et al. 2024).

Among the 10 valid species, the type species O. cotio is widespread in the Ganga basin of India and Bangladesh (Rahman et al. 2018). Three congeners, O. feae, O. cunma, and O. belangeri are distributed in Myanmar and the Irrawaddy drainage in India and China (Rahman et al. 2018). Doi (1997) reported O. alfredianus, O. belangeri, and O. feae from the Salween basin, but Laskar et al. (2024) questioned the validity of O. alfredianus. Silas (1952) described O. peninsularis from peninsular India. Two more species, O. neilli and O. bakeri are found in extreme southern peninsular India (Talwar & Jhingran 1991; Jadhav et al. 2011; Rahman et al. 2018). Shangningam et al. (2020) described O. tikarpadaensis from the Mahanadi River in Odisha and recognized O. dayi as a valid species. Laskar et al. (2024) states that O. vigorsii is limited to the Krishna River system in southern India, while the distribution of O. tikarpadaensis extends to the Godavari River drainages of South India. Morphologically, O. peninsularis closely resembles O. cotio, leading to frequent misidentifications due to their narrow range of morphological variations. The species is currently listed as Data Deficient on the IUCN Red List, raising questions about its record from Kerala (Dahanukar 2011).

This study suggests the extension of the distribution of O. peninsularis, which was previously documented only in southern India, by identifying the species from a new location in eastern India: Kangsabati River in the state West Bengal. DNA barcoding of specimens from southern India and eastern India further confirms the identification of O. peninsularis. These findings align with the original description of the species, with minor variations, and is a first report of O. peninsularis in eastern Indian drainage.

Materials and Methods

Morphometric and meristic data were recorded following Jayaram (1999). Measurements were taken on the left side of the specimens using digital calipers to the nearest 0.1 mm. Fin rays and scale counts were performed under transmitted light with a stereomicroscope. All pored scales were counted for reporting the lateral line scale. The count of transverse scale rows, between the lateral line and the origin of the dorsal-fin, include the lateral line scale. Body subunits are expressed as a percentage of standard length (SL), while head subunits are presented as a percentage of head length (HL). The specimens have been deposited at the Zoological Survey of India (ZSI), Kolkata, and at the Freshwater Biology Regional Centre of the Zoological Survey of India, Hyderabad.

Genetic analysis. Tissue samples were obtained from freshly collected specimens of O. peninsularis and preserved in 90% ethanol. The genomic DNA was extracted through QIAamp DNA Mini Kit (Qiagen, Valencia, CA) following the manufacturer’s protocol. The published primer pair (Ward et al. 2005): FishF1-5′TCAACCAACCACAAAGACATTGGCAC3′ and FishR1-5′TAGACTTCTGGGTGGCCAAAGAATCA3′ was used to amplify the partial segment of mitochondrial cytochrome oxidase C subunit I gene (COI). The 30 µl PCR mixture contains 10 pmol of each primer, 100 ng of DNA template, 1 × PCR buffer, 1.0–1.5 mM of MgCl2, 0.25 mM of each dNTPs, and 1U of Taq polymerase (Takara BIO Inc., Japan). The thermal profile was set to initial 2 min at 95 °C followed by 35 cycles of 0.5 min at 94 °C, 0.5 min at 54 °C, and 1 min at 72 °C, followed in turn by 10 min at 72 °C and subsequent hold at 4°C. The PCR products were further purified using QIAquickR Gel extraction Kit (Qiagen, Valencia, CA).

The cycle sequencing and Sanger sequencing was executed commercially. Both forward and reverse chromatograms were checked through SeqScanner V1.0 (Applied Biosystems Inc., CA, USA), nucleotide BLAST (https://blast.ncbi.nlm.nih.gov/), and ORF finder (https://www.ncbi.nlm.nih.gov/orffinder/) to trim the low-quality reads and gaps. The DNA sequences generated as part of the current study have been deposited in GenBank with accession No. MT896379 & PQ333057 for O. peninsularis; MZ854239 & MZ854240 for O. cotio. We retrieved all the available COI sequences of Osteobrama species from GenBank (https://www.ncbi.nlm.nih.gov/nucleotide/, assessed on 28 August 2023) and ran a test of neighbor-joining phylogeny. Based on the cohesive clustering, a maximum of five representative database sequences from each conspecific clade were used in the refined analysis. Following Rahman et al. (2018), uncertain sequences of O. cotio from Narmada River basin as well as from Karnafuli and Sangu Rivers were not included in the dataset. Further, a maximum of five representative sequences of three congeners used in Rahman et al. (2018), O. belangeri, O. cunma, and O. feae were used in the dataset. The dataset was aligned using ClustalX (Thompson et al. 1997) and the Kimura 2 parameter (K2P) genetic distances were estimated by using MEGAX (Kumar et al. 2018).

Results

Material examined

Osteobrama peninsularis Silas 1952 (Image 1, and Table 1 and 2): ZSI FF 9901, 1, 69.4 mm SL, Kangshabati (or Kansai) River, Paschim Medinipur District, West Bengal, India (22.406⁰N & 87.307⁰E), collected by S. Rath, 14 October 2022. Genbank accession for mtCOI sequence: PQ333057; FBRC/ZSI/F3549, 1, 68.0 mm SL, Wyra lake, Godavari River drainage, Khammam District, Telangana, India, collected by Sudipta Mandal, 20 July 2020. Genbank accession for mtCOI sequence: MT896379.

Description

Body deep, laterally compressed. Dorsal profile sloping upward linearly to nape, then in a broad curve to dorsal fin origin, forming a distinct hump, then sloping gradually downward towards caudal peduncle. Ventral profile strongly curved from tip of snout to origin of anal fin. Head compressed longer than deep. Eye large situated anteriorly on head, visible from dorsal and ventral side. Mouth terminal, obliquely directed upwards. Barbels absent.

Dorsal fin with iii unbranched and eight branched rays, last unbranched ray stiff and serrated. Pectoral fin with i unbranched and 14 branched rays. Pelvic fin i unbranched and eight branched rays. Anal fin long with iii unbranched rays and 29 branched rays. Caudal fin deeply forked with 9+8 branched rays. Scales small in size. Pre-dorsal scale 24. Lateral line complete with 58 scales.

Coloration

In preserved specimens, dorsal and dorsolateral surfaces of head and body faint brown, lateral surface of body greyish, become lighter ventrally. Dorsal, pectoral, pelvic, anal and caudal fin is pale white. An oblique black streak immediately posterior to opercle, parallel to upper opercular margin present.

Genetic analysis

The mtCOI sequences (denovo) of both the specimens of Osteobrama peninsularis in the study, cluster together. In the phylogram (Figure 1), the denovo sequences of O. peninsularis along with a few sequences borrowed from GenBank (with taxa name O. cotio) form a distinct clade. The sequences in the O. peninsularis clade show 0.0 to 0.62 % pairwise genetic distance (intraspecies divergence) and maintain 5.28 to 5.68% genetic distance (interspecies divergence) with the sequences in the clade of O. cotio. The clade of O. peninsularis corresponds with one of the subclades of Clade A referred in Rahman et al. (2018). Notwithstanding to having a considerable range of genetic divergence among the three subclades in Clade A of O. cotio, Rahman et al. (2018) stated that “The haplotype group represented by the sequences from the Narmada, Karnafuli, Sangu, and Godavari drainages may represent a distinct species but not necessarily undescribed. Based on the very brief description (Silas 1952) and data on topotypes in Jadhav et al. (2011), the oldest alternative available name may be O. peninsularis, with type locality Pune (Maharashtra, India) in the upper Krishna River drainage”. Based on the COI sequences, we consider that the three sequences (KF550101 to KF550103) with no locality information but identified as O. cotio in NCBI are in fact O. peninsularis.

Discussion

In this study, specimens were identified as Osteobrama peninsularis based on morphological characteristics, including 58 lateral line scales, the absence of barbels, and an anal fin with 29 branched rays. This species, originally described from Pune (Poona) in the upper Krishna River drainage of Maharashtra, has been frequently reported in Maharashtra (Silas 1952; Tonapi & Mulherkar 1963; Kharat et al. 2000, 2003; Arunachalam et al. 2002; Wagh & Ghate 2003; Chandanshive et al. 2007; Heda 2009; Jadhav & Yadav 2009).

Biju et al. (1999) reported O. peninsularis from the Periyar River in Central Kerala, indicating a range extension into Kerala. They, along with Talwar & Jhingran (1991) and Jayaram (1999), recognized the species as distributed solely in peninsular India, including Maharashtra, Odisha, Andhra Pradesh (erstwhile), and Kerala. The species has also been documented in the Tungabhadra River, Karnataka (Shahnawaz & Venkateshwarlu 2009; Shahnawaz et al. 2010). Although previous studies (Jayaram & Mazumdar 1976; Mohanty et al. 2015) noted its occurrences in Odisha, Dutta et al. (1993) did not include it in the state fauna series of Odisha.

Morphologically, O. peninsularis is superficially similar to O. belangeri, O. cotio, O. cunma because of lack of barbels. However, it is distinguished from all the three congeners in having pre-dorsal 21 to 24 scales and Lateral line scales 55 to 60. Furthermore, it is distinguished from O. belangeri in having more branched anal-fin rays (28–31 vs. 17–18), less pre-dorsal scales (21–24 vs. 31–34), less lateral line scales (55–60 vs. 70–78); from O. cotio in having less branched anal-fin rays (28–31 vs. 33–38), less lateral line scales (55–60 vs. 65); from O. cunma in having more branched anal-fin rays (28–31 vs. 25–29), less pre-dorsal scales (21–24 vs. 28–30) and more lateral line scales (55–60 vs. 42–53). This study largely aligns with the original description of O. peninsularis, noting only minor variations in body morphometry (see Table 1). Parameters of meristic counts, provide insights into the species’ morphological consistency across different populations. The specimens examined were smaller than the type specimens, and minor variations may relate to their distribution. The findings indicate that the distribution of O. peninsularis extends through the river basins of the Godavari and Krishna in Maharashtra, Telangana, Andhra Pradesh, and into the Mahanadi basin in Odisha and the Subarnarekha river basin in West Bengal. In a recent study, amendment of description of O. vigorsii and the expansion of distribution of O. tikarpadaensis have also been reported (Laskar et al. 2024). With the addition of O. peninsularis, the state fauna of West Bengal now includes two species of Osteobrama. A distribution map of O. peninsularis is given in Figure 2.

The presence or absence of barbels is a crucial taxonomic feature in Osteobrama (Hora & Misra 1940; Shangningam et al. 2020). When present, the barbels may be either one pair of maxillary barbels or both maxillary and rostral, sometimes being minute or rudimentary. The rostral barbels can be hidden or barely visible, while in some species, they extend to the base of the maxillary barbels. Osteobrama species are categorized into three groups based on their barbels: (i) with four well-defined barbels, (ii) with two rudimentary maxillary barbels, and (iii) without barbels (Hora & Misra 1940). Recently, O. vigorsii was revised and placed in Group (i), alongside O. bakeri, O. feae, O. neilli, and O. tikarpadaensis (Laskar et al. 2024).

Table 1. Morphometric Measurements of Osteobrama peninsularis from West Bengal (ZSI FF 9901). The table presents various body dimensions, expressed in millimeters and as percentages of standard length (SL) and head length (HL), providing a detailed overview of the species’ morphological characteristics.

	Parameters	value
1	Standard Length	69.4 mm
	% SL
2	Body Depth	42.22
3	Head Length (Lateral)	23.92
4	Head depth (Occiput)	19.45
5	Snout Length	6.20
6	Eye Diameter	8.36
7	Inter orbital Width	8.79
8	Max. Head width	12.39
9	Gape Width	5.48
10	Internerial space	4.76
11	Body width at anal fin origin	9.51
12	Body width at dorsal fin origin	11.67
13	Caudal Peduncle Length	9.37
14	Caudal Peduncle Depth	12.54
15	Dorsal-fin base Length	13.40
16	Dorsal-fin Length	26.37
17	Pectoral-fin Length	17.00
18	Pelvic-fin Length	14.99
19	Anal-fin base Length	37.03
20	Anal-fin Length	40.35
21	Caudal fin length	24.93
22	Median caudal fin Length	11.53
23	Predorsal Length	51.30
24	Prepectoral Length	22.05
25	Prepelvic Length	39.48
26	Preanal Length	53.31
27	Pelvic anal distance	15.85
	% HL
28	Snout Length	25.90
29	Eye Diameter	34.94
30	Inter Orbital Width	36.75
31	Max. Head Width	51.81
32	Gape Width	22.89
33	Internerial space	19.88

Table 2. Meristic counts of Osteobrama peninsularis from different locations. This table summarizes the meristic characteristics of O. peninsularis specimens from West Bengal (ZSI FF 9901) and Wyra Lake in Telangana (FBRC/ZSI/F3549), alongside counts from previous literature (Silas 1952).

Parameters	O. peninsularis from W.B.: ZSI FF 9901	O. peninsularis from, Wyra Lake, Godavari Drainage, Telangana: FBRC/ZSI/F3549	O. peninsularis original descriptions by Silas (1952)
Dorsal fin	iii 8	iii 8	iii 9
Pectoral fin	i 14	i 14	16
Pelvic fin	i 8	i 9	i 9
Anal fin	ii 29	ii 30	iii 28-31
Lateral line scales	58	58	55-60
Predorsal scales	24	24	21-24
Pre-anal scales	21	-	-

for figures & image – click her for PDF

References

Arunachalam, M., A. Sankaranarayanan, A. Manimekalan, R. Soranam & J.A. Johnson (2002). Fish fauna of some streams and rivers in the Western Ghats of Maharashtra. Journal of the Bombay Natural History Society 99(2): 337–341.

Biju, C.R., K.R. Thomas & C.R. Ajithkumar (1999). Range extension of Osteobrama cotio peninsularis Silas to Kerala. Miscellaneous notes, Journal of the Bombay Natural History Society 96(3): 481–482.

Bleeker, P. (1863). Systema Cyprinoideorum revisum. Nederlandsch Tijdschrift voor de Dierkunde 1: 187–218.

Chandanshive, E.N., S.M. Kamble & B.E. Yadav (2007). Fish fauna of Pavana River of Pune, Maharashtra. Zoos’ Print Journal 22(5): 2693–2694. https://doi.org/10.11609/JoTT.ZPJ.1481.2693-4

Dahanukar, N. (2011). Osteobrama cotio ssp. peninsularis. The IUCN Red List of Threatened Species 2011: e.T172512A6907036. https://doi.org/10.2305/IUCN.UK.2011-1.RLTS.T172512A6907036.en. Accessed on 05 December 2023.

Doi, A. (1997). A review of taxonomic studies of cypriniform fishes in Southeast Asia. Japanese Journal of Ichthyology 44(1): 1–33.

Dutta, A.K., D.K. Kunda & A.K. Karmakar (1993). Fresh water fishes, pp. 1–37. In: State Fauna Series 1: Fauna of Orissa. Part 4. Zoological Survey of India, Kolkata, India.

Hamilton, F. (1822). An Account of the Fishes Found in the River Ganges and its Branches. Edinburgh and London, vii + 405 pp, 39 pls.

Heda, N.K. (2009). Fish diversity studies of two rivers of the northeastern Godavari basin, India. Journal of Threatened Taxa 1(10): 514–518. https://doi.org/10.11609/JoTT.o1764.514-8

Hora, S.L. (1937). Notes on fishes in the Indian Museum. XXXII. On a small collection of fish from the Upper Chindwin drainage. Records of the Indian Museum 89(4): 331–338.

Hora, S.L. & K.S. Misra (1940). Notes on fishes in the Indian museum. XL. On fishes of the genus Rohtee Sykes. Records of the Indian Museum 42(1): 155–172.

Jadhav, S.S. & B.E. Yadav (2009). A note on the ichthyofauna of Solapur District with first report of cyprinid fish, Rasbora caverii (Jerdon) from Maharashtra state, India. Journal of Threatened Taxa 1(4): 243–244. https://doi.org/10.11609/JoTT.o1660.243-4

Jadhav, S., M. Paingankar & N. Dahanukar (2011). Osteobrama bhimensis (Cypriniformes: Cyprinidae): a junior synonym of O. vigorsii. Journal of Threatened Taxa 3(9): 2078–2084. https://doi.org/10.11609/JoTT.o2841.2078-84

Jayaram, K.C. (1999). The Freshwater Fishes of Indian Region. Narendra Publishing House, New Delhi, 551 pp.

Jayaram, K.C. & N. Majumdar (1976). On a collection of fish from the Mahanadi. Records of the Zoological Survey of India 69: 305–323.

Jordan, D.S. (1919). The genera of fishes, part III, from Guenther to Gill, 1859-1880, twenty-two years, with the accepted type of each. A contribution to the stability of scientific nomenclature. Leland Stanford Jr. University Publications, University Series 39: 285–410.

Kharat, S., N. Dahanukar & R. Raut (2000). Decline of fresh-water fish of Pune urban area. Journal of Ecological Society 13/14: 46–51.

Kharat, S., N. Dahanukar, R. Raut & M. Mahabaleshwarkar (2003). Long-term changes in freshwater fish species composition in Northern Western Ghats, Pune District. Current Science 84(6): 816–820.

Kumar, S., G. Stecher, M. Li, C. Knyaz & K. Tamura (2018). MEGA X: molecular evolutionary genetics analysis across computing platforms. Molecular Biology and Evolution 35: 1547–1549. https://doi.org/10.1093/molbev/msy096

Laskar, B.A., D. Banerjee, S. Chung, H.-W. Kim, A.R. Kim & S. Kundu (2024). Integrative taxonomy clarifies the historical flaws in the systematics and distributions of two Osteobrama fishes (Cypriniformes: Cyprinidae) in India. Fishes 9: 87. https://doi.org/10.3390/fishes9030087

Mohanty, S.K., S.S. Mishra, M. Khan, R.K. Mohanty, A. Mohapatra & A.K. Pattnaik (2015). Ichthyofaunal diversity of Chilika Lake, Odisha, India: an inventory, assessment of biodiversity status and comprehensive systematic checklist (1916–2014). Check List 11(6): 1–19. https://doi.org/10.15560/11.6.1817

Mukerji, D.D. (1934). Report on Burmese fishes collected by Lt. Xol. R.W. Burton from the tributary streams of the Mali Hka River of the Myitkyina District (Upper Burma). Journal of the Bombay Natural History Society 37 (1): 38–80.

Rahman, M.M., M. Noren, A.R. Mollah & S. Kullander (2018). The identity of Osteobrama cotio, and the status of “Osteobrama serrata” (Teleostei: Cyprinidae: Cyprininae). Zootaxa 4504(1): 105–118. https://doi.org/10.11646/zootaxa.4504.1.5

Shahnawaz, A. & M. Venkateshwarlu (2009). A checklist of fishes from the Tunga and Bhadra rivers, Karnataka, India with a special note on their biodiversity status. Current Biotica 3(2): 232–243.

Shahnawaz, A., M. Venkateshwarlu, D.S. Somashekar & K. Santosh (2010). Fish diversity with relation to water quality of Bhadra River of Western Ghats, India. Environmental Monitoring and Assessment 161: 83–91.

Shangningam, B., S. Rath, A.K. Tudu & L. Kosygin (2020). A new species of Osteobrama (Teleostei: Cyprinidae) from the Mahanadi River, India with a note on the validity of O. dayi. Zootaxa 4722(1): 68–76. https://doi.org/10.11646/zootaxa.4722.1.6

Silas, E.G. (1952). Further studies regarding Hora’s Satpura hypothesis. Proceedings of the National Institute of Sciences of India 18(5): 423–448.

Sykes, W.H. (1838). On the fishes of the Deccan. Proceedings of the General Meetings for Scientific Business of the Zoological Society of London 6: 157.

Talwar, P.K. & A.G. Jhingran (1991). Inland fishes of India and adjacent countries. Oxford and IBH publishing Co., New Delhi, Bombay and Calcutta, 541 pp.

Thompson, J.D., T.J. Gibson, F. Plewniak, F. Jeanmougin & D.G. Higgins (1997). The CLUSTAL_X windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acids Research 25: 4876–4882.

Tilak, R. & A. Husain (1989). Description of a new cyprinid, Osteobrama brevipectoralis sp. nov. from Manipur, India with remarks on the systematic position of the genus Osteobrama Heckel and allied genera. Mitteilungen aus dem Zoologischen Museum in Berlin 65(2): 327–333.

Tonapi, G.T. & L. Mulherkar (1963). Notes on the freshwater fauna of Poona, Part 1: Fishes. Proceedings of the Indian Academy of Sciences 58: 187–197.

Wagh, G.K. & H.V. Ghate (2003). Freshwater fish fauna of the rivers Mula and Mutha, Pune, Maharashtra. Zoos Print Journal 18(1): 977–981. https://doi.org/10.11609/JoTT.ZPJ.18.1.997

Ward, R.D., T.S. Zemlak, B.H. Innes, P.R. Last & P.D.N. Hebert (2005). DNA barcoding of Australia’s fish species. Philosophical Transactions of the Royal Society B 360: 1847–1857.