Journal of Threatened Taxa | www.threatenedtaxa.org | 26 May 2024 | 16(5): 25243–25251

 

ISSN 0974-7907 (Online) | ISSN 0974-7893 (Print) 

https://doi.org/10.11609/jott.8742.16.5.25243-25251

#8742 | Received 16 September 2023 | Final received 18 March 2024 | Finally accepted 15 April 2024

 

 

Taxonomy and molecular systematics of marasmioid fungi (Basidiomycetes: Agaricales: Marasmiaceae) occurring in Puducherry, India

 

 Yuvarani Krishnan 1 , Thokur Sreepathy Murali 2, Gunasekaran Senthilarasu 3 & Vadivelu Kumaresan 4

 

1,4 Department of Botany, Kanchi Mamunivar Government Institute for Postgraduate Studies and Research, Puducherry 605008, India.

2 Department of Public Health Genomics, Manipal School of Life Sciences, Manipal Academy of Higher Education, Manipal, Karnataka 576104, India.

3 British Agro Products (India) Pvt. Ltd., Puluthivakkam, Kanchipuram District, Tamil Nadu 603314, India.

1 yuvarani96botany@gmail.com, 2 murali.ts@manipal.edu, 3 senthilarasug28@gmail.com,

4 vkumaresan36@gmail.com (corresponding author)

 

 

Editor: Arun Kumar Dutta, Gauhati University, Guwahati, India.                     Date of publication: 26 May 2024 (online & print)

 

Citation: Krishnan, Y., T.S. Murali, G. Senthilarasu & V. Kumaresan (2024). Taxonomy and molecular systematics of marasmioid fungi (Basidiomycetes: Agaricales: Marasmiaceae) occurring in Puducherry, India. Journal of Threatened Taxa 16(5): 25243–25251. https://doi.org/10.11609/jott.8742.16.5.25243-25251

  

Copyright: © Krishnan et al. 2024. Creative Commons Attribution 4.0 International License.  JoTT allows unrestricted use, reproduction, and distribution of this article in any medium by providing adequate credit to the author(s) and the source of publication.

 

Funding: Self-funded.

 

Competing interests: The authors declare no competing interests.

 

Author details: Ms. Yuvarani Krishnan is a research scholar pursuing Ph.D. in Botany with interest in macrofungal diversity and fungal endophytes. Dr. Thokur  Sreepathy  Murali is currently professor and head, Department of Public Health Genomics in Manipal School of Life Sciences, Manipal Academy of Higher Education. His research focusses on diversity of micro and macrofungi, virulence factors in infectious microbes and fungal secondary metabolites. Dr. Gunasekaran Senthilarasu is an expert in gilled fungal identification who has worked extensively in southern as well as western parts of India including Western and Eastern Ghats. Presently he is working on the cultivation of white button mushrooms. Dr. Vadivelu Kumaresan is an assistant professor of botany at Kanchi Mamunivar Govt. Institute for Postgraduate Studies and Research (Autonomous), Puducherry. He has been working on the diversity of macrofungi in Puducherry and other parts of southern India including Western Ghats, and fungal endophytes of various groups of plants.

 

Author contributions: YK—undertook field trips to sample gilled fungi, recorded macro- and microscopic characters. TSM—analysed the ITS sequence and carried out phylogenetic analysis. SG—assisted in identifying and describing some of the species of agarics mentioned in the present study. VK—carried out field trips to various places in Puducherry to record gilled fungi. He reviewed the morphological and microscopic characterization of marasmioid fungi done by the scholar and wrote the manuscript.

 

Acknowledgements: VK thanks the director and head of the Department of Botany, KMGIPSR, Puducherry for facilities and encouragement.

 

 

Abstract: In this study, five species of Marasmius namely, M. bambusiniformis, M. haematocephalus, M. leveilleanus, M. midnapurensis, and M rotalis, plus Paramarasmius palmivorus are described, based on morphotaxonomic and molecular characters. Sequence data from internal transcribed spacers were used for phylogenetic analyses of the six species, supporting their identification based on macro and micromorphological characters. All of these species are reported for the first time from Puducherry region.

 

Keywords: Agaricales, Basidiomycota, litter fungi, Marasmiaceae, molecular characterization, morphotaxonomy, mushrooms, Paramarasmius, phylogeny, southern India.

 

INTRODUCTION

 

The genus Marasmius Fr. (Marasmiaceae Roze ex Kühner) was first accepted by Elias Magnus Fries in 1835 (Tan et al. 2009). Singer (1986) recognized 12 different sections, viz., Androsacei, Hygrometrici, Leveilleani, Scotophysini, Epiphylli, Marasmius, Sicci, Inaequales, Fusicystides, Neosessiles, Alliacei, and Globulares that were represented by 356 species. However, the genus Marasmius sensu lato, according to Singer (1986), is polyphyletic. Based on the phylogenetic analysis of nuclear ribosomal Large Subunit rRNA gene (nLSU), the members of the section Androsacei were merged into the genus Gymnopus, whereas the section Alliacei, along with some other members, was elevated to the generic level as Mycetinis. The sections Hygrometrici, Leveilleani, Scotophysini, Marasmius, Sicci, Neosessiles, and Globulares were recognized by Wilson & Desjardin (2005).

The genus Marasmius is one of the largest genera of the order Agaricales, comprising about 600 species that are distributed worldwide, particularly in tropical regions (Wannathes et al. 2009). A review of literature revealed that more than 80 species have been listed in India (Manjula 1983; Natarajan et al. 2005; Kaur & Gupta 2019). Of these, 13 species have been newly described from different regions (Dutta et al. 2015; Farook & Manimohan 2015; Das et al. 2019; Manoharachary et al. 2022). The present study records the occurrence of five species of Marasmius in Puducherry, namely, M. bambusiniformis Singer, M. haematocephalus (Mont.) Fr., M. leveilleanus (Berk.) Sacc. & Trotter, M. midnapurensis A.K.Dutta, P.Pradhan & K.Acharya, and M. rotalis Berk. & Broome and a species of Paramarasmius, viz., P. palmivorus (Sharples) Antonín & Kolařík. All these species are being reported for the first time in the Puducherry region. Marasmius midnapurensis, a recently described new species from West Bengal, India (Dutta et al. 2014), was also collected and studied, and is being reported for the first time in southern India. It is pertinent to mention that Kumaresan et al. (2021) reported three species belonging to Marasmiaceae among 33 species of gilled fungi reported from Puducherry, but none belonging to the genus Marasmius.

 

 

MATERIALS AND METHODS

 

Study area

The basidiomes of Marasmius spp. were collected from various places of Puducherry, India during the north-east monsoon season of November and December 2021.

 

Sampling and morphological characterization

During sampling, photographs of basidiomes were taken, and morphological characters such as colour (Kornerup & Wanscher 1978), size, and gill attachment were recorded in the field (Senthilarasu & Kumaresan 2018). The basidiomes were dried using an electric drier at 50°C for an hour or more depending on their delicate nature or thick fleshy texture. The dried basidiomes were sealed carefully in polythene covers after labeling, for further microscopic studies. The samples are being maintained in the mushroom herbarium collection in the Department of Botany, Kanchi Mamunivar Government Institute for Postgraduate Studies and Research, Puducherry, India by designating unique alphanumeric numbers.

The thin hand-made sections taken from basidiomes were revived in 5% KOH, stained in 1% phloxine B and observed under the microscope (Labomed iVu 3100); camera lucida diagrams were drawn. Microscopic characters such as shape and size of basidia, basidioles, basidiospores were observed, presence or absence of pluerocystidia, cheilocystidia, pileocystidia, and caulocystidia with their shape and size were recorded following Largent et al. (1977). Around 20 measurements for basidia and cystidia were derived from each specimen. Xm is the arithmetic mean of the spore length and spore width with standard deviation for n spores. The spore quotient (Q) was obtained by dividing the spore length by its width and Qm was calculated by the mean of Q-values (Zhang et al. 2017).

 

DNA extraction and PCR amplification

Basidiomes of Marasmius spp. were processed for genomic DNA isolation following the method of Gardes & Bruns (1993). Primers ITS1 (TCCGTAGGTGAACCTGCGG) and ITS4 (TCCTCCGCTTATTGATATGC) were used for PCR amplification of the internal transcribed spacer (ITS) region (White et al. 1990). The PCR reaction mixture consisted of 2X Phire Master Mix 5 μL, distilled water 4 μL, ITS1 0.25 μL, ITS2 0.25 μL, and genomic DNA 50 ng. The PCR amplification was formed as follows: 98 oC for 30 s, 40 cycles of 98 oC for 5 s, 58 oC for 10 s, 72 oC for 15 s; 72 oC for 60 s, 4 oC for ∞. The PCR products were purified and sequenced using ABI 3500 DNA Analyzer (Applied Biosystems), prior to which sequencing reaction was done in a PCR thermal cycler (GeneAmp PCR System 9700, Applied Biosystems) using the BigDye Terminator v3.1 Cycle sequencing Kit (Applied Biosystems, USA).

 

Phylogenetic analyses

Sequences with significant matches obtained using NCBI Blast were selected and aligned using ClustalW (Thompson et al. 1994), and evolutionary history was inferred using the Neighbour-Joining Approach and Maximum Likelihood approach using MEGA11 (Tamura et al. 2021). A bootstrap test (1,000 replicates) was performed and the percentage of replicate trees in which the same taxa clustered together is given next to the branches (Felsenstein 1985). For neighbour joining tree, evolutionary distances were calculated using maximum composite likelihood model (Tamura et al. 2004), while Tamura-Nei model was used for maximum likelihood tree (Tamura & Nei 1993). The species Crinipellis zonata was used as an out-group for the analysis. Accession numbers of sequences belonging to the genera Marasmius and Paramarasmius included in the phylogenetic analysis are given in Table 1.

 

 

RESULTS

 

Marasmius bambusiniformis, M. haematocephalus, M. leveilleanus, M. midnapurensis, M. rotalis, and P. palmivorus collected and described in this study are newly reported to Puducherry.

 

Taxonomy

Marasmius bambusiniformis Singer, Fl. Neotrop., Monogr. 17: 1C7 (1976) (Image 1a–e)

Pileus 4–11 mm diam., conical with small umbo, dull, disc brownish orange (5C5), pale red (7B3) towards margin. Lamellae adnexed, subdistant, cream white. Stipe 12–26 × 2–3 mm, brown (7D7), light yellow towards the apex, central, wiry, non-insititious.

Basidiospores 14–16 × 3–4 µm (Xm = 15.4 ± 0.7 × 3.8 ± 0.1 µm, Q = 3.5–4.0, Qm = 3.9 ± 0.1), narrowly fusoid, thin-walled, hyaline, inamyloid. Basidia not observed. Basidioles 20–24 × 4–6 µm, fusoid to clavate. Cheilocystidia of Siccus-type broom cells, main body 8–17 × 7–10 µm, cylindrical to clavate, inamyloid, thin-walled, apical setulae 2–6 × 1–1.5 µm. Pleurocystidia absent. Pileal elements composed of Siccus-type broom cells, main body 9–15 × 8–11 µm, cylindrical to clavate, crowded, thick-walled, apical setulae 2–6 × 1–1.5 µm. Clamp connections present.

Specimen examined: Lawspet, Puducherry, gregarious on twig litter. K. Yuvarani (PYKM136, GenBank: OP415534).

Notes: The basidiomes of M. bambusiniformis reported from Thailand is similar in pileal size (3–10 mm diam.) with slight variation in having reddish brown to brownish orange pileus (Wannathes et al. 2009). The Malaysian species of M. bambusiniformis slightly differs from present collection morphologically in smaller pileus (1.5–5 mm diam.) and microscopically having slightly longer basidiospores of up to 19 µm (Tan et al. 2009). This is the first record from southern India.

 

Marasmius haematocephalus (Mont.) Fr., Epicr. syst. mycol (Upsaliae): 382 (1838) [1836–1838] (Image 2a–g)

Pileus 4–11 mm diam., convex, sulcate striate, dull, orangish red (8B6) to pastel red (8B5). Lamellae free to adnexed, subdistant, white. Stipe 10–28 × 3–4 mm, central, cylindrical, wiry, smooth, white above, reddish brown (8D5) towards base.

Basidiospores 17–19 × 4–5 µm (Xm = 18.4 ± 0.7 × 4.9 ± 0.1, Q = 3.4–3.8, Qm = 3.7 ± 0.1), clavate to fusoid, often curved, inamyloid. Basidia not observed. Basidioles 23–26 × 5–6 µm, fusoid to clavate. Cheilocystidia composed of Siccus-type of broom cells 9–16 × 5–8 µm, cylindrical to clavate, crowded, inamyloid, thin-walled, apical setulae 2–5 × 1 µm. Pleurocystidia 35–39 × 7–9 µm, gloeocystidioid, fusoid to clavate, at times mucronate, inamyloid, thin-walled. Pileal elements hymeniform, composed of Siccus- type broom cells, 10–19 × 6–8 µm, clavate, inamyloid, apical setulae 2–6 × 1–2 µm. Clamp connections present.

Specimen examined: Veerampattinam, Puducherry, gregarious on soil along with grass, 28 October 2021, K. Yuvarani (PYKM110, GenBank: OP415535).

Notes: Marasmius haematocephalus is known to occur widely and has been reported from Tamil Nadu (Natarajan and Manjula 1983), Kerala & Maharashtra (Manoharachary et al. 2022), and Assam (Roy et al. 2022).

 

Marasmius leveilleanus (Berk.) Sacc. & Trotter, Syll. fung. (Abellini) 23: 149 (1925) (Image 3a–f)

Pileus 5–18 mm diam., convex to hemispherical when young, becoming convex to depressed in the central part, umbilicate, dull to shiny, reddish-orange (7B6) to pastel red (8B3); margin brownish-orange (5C5). Lamellae free, subdistant, broad, white or cream. Stipe 9–25 × 5–8 mm, central, cylindrical, brownish-red (8E7), insititious.

Basidiospores 10–12 × 4–5 µm (Xm = 10.8 ± 0.6 × 4.7 ± 0.4, Q = 2.2–2.5, Qm = 2.3 ± 0.1), ellipsoid, inamyloid, thin-walled. Basidia 20–23 × 6–9 µm, cylindrical to clavate, 4-spored, inamyloid. Cheilocystidia of Siccus-type broom cells, main body 16–28 × 6–9 µm, cylindrical to clavate, thin-walled, inamyloid with apical setulae 1–4 × 1–1.5 µm. Pileipellis hymeniform, composed of Siccus-type broom cells, main body clavate to oblong, 15–22 × 7–10 µm, thin to thick-walled, inamyloid, with apical setulae 3–5 × 1.5–3 µm. Clamp connections present.

Specimen examined: Puthupattu, Puducherry, scattered on twigs and decaying wood, 7 December 2021, K. Yuvarani (PYKMS14, GenBank: OP415538).

Notes: Marasmius leveilleanus has been recorded from Tamil Nadu (Natarajan & Manjula 1982) and Kerala (Manoharachary et al. 2022).

 

Marasmius midnapurensis A.K.Dutta, P.Pradhan & K.Acharya, in Dutta, Chandra, Pradhan & Acharya, Mycotaxon 128: 119 (2014) (Image 4a–f)

Pileus 8–24 mm diam., convex to broadly convex, umbonate, smooth, moist, light brown (5D5) to light greyish-brown (6D3) with irregular light yellowish brown (5D6) patches in the pileus surface, hygrophanous, striate. Lamellae adnexed, subdistant, white (1B1), margin creamy, slightly undulating or even. Stipe 51–81 × 1.5–2 mm, central, creamy near the apex, reddish-brown (7D7) below, terete, hollow, dry, smooth, non-insititious, white to light yellow at the base.

Basidiospores 10–12 × 3–4 µm (Xm = 10.9 ± 0.9 × 3.9 ± 0.1, Q = 2.5–3.4, Qm = 2.7 ± 0.3) narrowly ellipsoid to fusoid, slightly curved, smooth, inamyloid, thin walled. Basidia 21–25 × 5–7 µm, clavate, 4-spored. Basidioles 19–23 × 5–7 µm, clavate. Cheilocystidia of Siccus-type broom cells, 11–17 × 6–10 µm, cylindrical to clavate, with thin to thick-walled apical setulae, 4–10 × 1–1.5 µm. Pleurocystidia absent. Pileipellis composed of Siccus-type broom cells, 12–16 × 7–11 µm, clavate, inamyloid, apical setulae crowded, 4–10 × 1–1.5 µm. Caulocystidia present. Clamp connections present.

Specimen examined: Lawspet, Puducherry, gregarious and scattered on twig and leaf litter, 27th August 2021, K. Yuvarani (PYKM76 & PYKM78, GenBank: OP415532, OP415533); Lawspet, gregarious and scattered, 30 August 2021, K. Yuvarani (PYKM87).

Notes: Marasmius midnapurensis was first described from Midnapur district of West Bengal, India (Dutta et al. 2014). Morphotaxonomically, the present collection resembles M. midnapurensis in all the characters, but slightly differs in having longer stipe (51–81 mm vs 53–65 mm).

 

Marasmius rotalis Berk. & Broome, J. Linn. Soc., Bot. 14 (no.73): 40 (1873) [1875] (Image 5a–f)

Pileus 3–6 mm diam., convex, umbilicate, striate, to sulcate; surface dull, dry, uniformly pale orange (5A3) to pale white (5A1), umbilicus with a darker central spot; margin undulating. Lamellae horizontal, distant, white. Stipe 14–10 × 2 mm, central, surface shiny, dry, reddish-brown (8E8) to brownish-red. Mycelium running over on attached leaf.

Basidiospores 6–8 × 4–5 µm (Xm = 7.6 ± 0.4 × 4.3 ± 0.4, Q = 1.6–2, Qm = 1.7 ± 0.1), ellipsoid, inamyloid, thin-walled. Basidia 20–23 × 4.5–5.5 µm, clavate, 4 spored, inamyloid. Cheilocystidia 10–12 × 8–10 µm, scattered of Rotalis-type broom cells, broadly clavate, thin walled. Pleurocystidia absent. Pileal surface with Rotalis-type broom cells, 10–15 × 10–12 µm, broadly clavate or pyriform or sub-vesiculose, thin-walled, inamyloid, Clamp connections present. Stipe hyphae up to 5 µm broad, thick-walled.

Specimen examined: Lawspet, Puducherry, scattered on leaf litter and fallen Caesalpinia fruit, 30 October 2021, K. Yuvarani (PYKM101, GenBank: OP415536).

Notes: Marasmius rotalis was previously described from Madras (now Chennai), Tamil Nadu by Natarajan & Manjula (1982). The specimen examined in the present work is similar to M. rotalis described from Chennai in all the morphotaxonomic characters.

 

Paramarasmius palmivorus (Sharples) Antonín & Kolařík, in Antonín, Hosaka & Kolařík, Pl. Biosystems: 10.1080/11263504.2022.2100503, 2 (2022) (Image 6a–f)

Pileus 6–34 mm diam., hemispherical to convex, surface dull, moist to dry, young white, becoming yellowish white (1A2) when mature. Lamellae adnate, subdistant to distant, with 4 series of lamellulae. Stipe 4–12 × 1–1.5 mm, central to slightly eccentric, slightly enlarged at the base, white near the apex, light yellowish brown towards the base, insititious.

Basidiospores 10–12 × 5–6 µm (Xm = 11.4 ± 0.7 × 5.1 ± 0.6, Q = 2–2.6, Qm = 2.2 ± 0.2) ellipsoid, smooth, inamyloid, thin-walled. Basidia 35–37 × 7–9 µm, clavate, to cylindrical, 4-spored. Pleurocystidia absent. Cheilocystidia 24–26 × 8–11 µm, cylindrical to clavate, inamyloid, thin-walled, irregular in outline, with apical lobules. Pileipellis loosely interwoven, not a hymeniform layer, hyphae up to 8 µm wide, thin-walled.

Specimen examined: Puthupattu, Puducherry, sacred grove (Near Puducherry), gregarious on decaying coconut fibre, 28 October 2021, K. Yuvarani (PYKMS40, GenBank: OP415537).

Notes: The present collection resembles M. palmivorus (presently Paramarasmius palmivorus) reported by Dutta & Acharya (2018) from West Bengal in all the morphotaxonomic characters, but slightly differs in having longer cheilocystidia (24–26 µm vs up to 19 µm).

A phylogenetic analysis was performed on 41 ITS sequences of different species of Marasmius (seven from the current study and 33 from public databases) with Crinipellis zonata as outgroup. All ambiguous positions were removed for each sequence pair and the final dataset included 286 positions. Both Neighbour joining analysis and Maximum likelihood approach provided similar results with all our isolates clustered together in separate clades (Figures 1, 2). The boostrap support for different clades was found to be generally low across all nodes. When the isolates were separated based on the section to which they belonged, the members of section Marasmius formed a monophyletic clade with strong support (100%) while the species belonging to Paramarasmius (earlier reported as Marasmius palmivorus) were grouped together (100% bootstrap support).

 

 

Discussion

 

Of the five species of Marasmius examined, M. midnapurensis, M. bambusiniformis and M. haematocephalus belong to sect. Sicci, M. leveilleanus to sect. Leveilleani and M. rotalis to sect. Marasmius. Marasmius palmivorus displays unique pileipellis morphology (Dutta & Acharya 2018) and hence, Antonin et al. (2022) proposed a new combination P. palmivorous for M. palmivorous due to the absence of hymeniderm pileipellis in the latter. Marasmius midnapurensis is being described for the first time from southern India. Natarajan & Manjula (1982) reported M. haematocephalus, M. leveilleanus and M. rotalis from southern India. Wannathes et al. (2009) recognized six different forms of M. haematocephalus although not formally established and, to confirm this more specimens have to be analyzed. Further, Marasmius species are known to have their morphologically vicariant taxon in other geographical areas (Antonin et al. 2014) making molecular analysis an important tool in differentiating such species. Phylogenetic analysis using both neighbour joining method and maximum likelihood method gave similar results (Figures 1, 2). Our phylogenetic analysis further showed that Internal Transcribed Spacer might not be a reliable marker to distinguish different sections in genus Marasmius but had strong support for members of section Marasmius. A similar result was obtained by nuclear large subunit sequence analysis by Douanla-Meli and Langer (2008). Our results also agreed with that of Oliveira et al. (2020) in that the members of Globulares to be non-monophyletic and the clade included members from different sections and lacked stronger support.

 

Table 1. List of Marasmius species used for phylogenetic analysis.

Species

Country

Section

GenBank

accession no.

Marasmius cystidiatus 

India

Globulares

MH216191

Marasmius cystidiatus 

India

Globulares

MH216042

Marasmius leveilleanus

India

Leveilleani

KX154213

Marasmius leveilleanus

India

Leveilleani

OP415538*

Marasmius leveilleanus

Thailand

Leveilleani

MW426440

Marasmius leveilleanus

Sri Lanka

Leveilleani

KR733544

Marasmius brunneoaurantiacus 

China

Marasmius

MZ133622

Marasmius rotalis

India

Marasmius

MF189068

Marasmius rotalis

India

Marasmius

MF189069

Marasmius rotalis

India

Marasmius

OP415536*

Marasmius somalomoensis 

USA

Marasmius

KX149002

Marasmius tenuissimus

China

Neosessiles

MF061773

Marasmius midnapurensis 

India

Sicci

KY785179

Marasmius midnapurensis 

India

Sicci

MF189041

Marasmius midnapurensis 

India

Sicci

OP415532*

Marasmius midnapurensis 

India

Sicci

OP415533*

Marasmius haematocephalus

Thailand

Sicci

EU935525

Marasmius haematocephalus

Thailand

Sicci

EU935527

Marasmius haematocephalus

Thailand

Sicci

MW426462

Marasmius haematocephalus

India

Sicci

OP415535*

Marasmius auranticapitatus 

Brazil

Sicci

ON502671

Marasmius bambusiniformis 

Thailand

Sicci

MW504974

Marasmius bambusiniformis 

Thailand

Sicci

EU935521

Marasmius bambusiniformis 

Thailand

Sicci

EU935522

Marasmius bambusiniformis 

India

Sicci

MW453134

Marasmius bambusiniformis 

India

Sicci

OP415534*

Marasmius coasiaticus 

Brazil

Sicci

ON502681

Marasmius graminicola 

Korea

Sicci

FJ917618

Marasmius graminicola 

Korea

Sicci

FJ917617

Marasmius nodulocystis

USA

Sicci

KX953740

Marasmius nodulocystis

USA

Sicci

KX953742

Marasmius ochroleucus 

Russia

Sicci

KF912952

Marasmius rubicundus 

Brazil

Sicci

ON502659

Marasmius rubicundus 

Brazil

Sicci

ON502663

Marasmius strobiluriformis 

Korea

Sicci

GU266263

Paramarasmius palmivorus 

India

-

MK788181

Paramarasmius palmivorus 

USA

-

MF100969

Paramarasmius palmivorus

India

-

MG251431

Paramarasmius palmivorus

India

-

OP415537*#

Paramarasmius palmivorus 

Thailand

-

MW647877

Crinipellis zonata

USA

-

MK217458

*Marasmius spp. and Paramarasmius palmivorus recorded in the present study

#Submitted as Marasmius palmivorous, presently basionym of Paramarasmius palmivorus (Sharples) Antonín & Kolařík (2022).

For images - - click here for full PDF

 

References

 

Antonín, V., H. Kentaro & K. Miroslav (2022). Taxonomy and phylogeny of Paramarasmius gen. nov. and Paramarasmius mesosporus, a worldwide distributed fungus with a strict ecological niche. Plant Biosystems - An International Journal Dealing with all Aspects of Plant Biology 157(2): 286–293. https://doi.org/ 10.1080/11263504.2022.2100503

Antonin, V., R. Rhim, K. Kang-Hyeon & S. Hyeon-Dong (2014). Marasmioid and gymnopoid fungi of the Republic of Korea. 6. Marasmius sect. Marasmius. Mycoscience 55(2): 149–157.

Das, K., D. Chakraborty & V. Antonin (2019). A novel species of Marasmius sect. Globulares (Marasmiaceae) from Indian Himalaya. Kew Bulletin 74: 19.

Douanla-Meli, C. & E. Langer (2008). Phylogenetic relationship of Marasmius mbalmayoensis sp. nov. to the tropical African Marasmius bekolacongoli complex based on nuc-LSU rDNA sequences. Mycologia 100(3): 445–454.

Dutta, A.K. & K. Acharya (2018). A new host for the parasitic macrofungus Marasmius palmivorus Sharples (Marasmiaceae). Current Science 114(7): 1400–1402.

Dutta, A.K., S. Chandra, P. Pradhan & K. Acharya (2014). A new species of Marasmius sect. Sicci from India. Mycotaxon 128: 117–125.

Dutta, A.K., K. Das & K. Acharya (2015). A new species of Marasmius sect. Globulares from Indian Himalaya with tall basidiomata. Mycosphere 6(5): 560–567. https://doi.org/10.5943/mycosphere/6/5/5

Felsenstein, J. (1985). Confidence limits on phylogenies: An approach using the bootstrap. Evolution 39: 783–791.

Gardes, M. & T.D. Bruns (1993). ITS primers with enhanced specificity for basidiomycetes – application to the identification of mycorrhizae and rusts. Molecular Ecology 2: 113–118. https://doi.org/10.1111/j.1365-294X.1993.tb00005.x

Kaur, M. & A. Gupta (2019). New records of genus Marasmius (Marasmiaceae) from India. Kavaka 53: 92–95.

Kornerup, A. & J.H. Wanscher (1978). Methuen Handbook of Colour. 3rd ed. Eyre Methuen, London, 243 pp.

Kumaresan, V., C. Sariha, T.S. Murali & G. Senthilarasu (2021). Occurrence of gilled fungi in Puducherry, India. Journal of Threatened Taxa 13(7): 18878–18887. https://doi.org/10.11609/jott.6978.13.7.18878-18887

Largent, D.L., D. Johnson & R. Watling (1977). How to identify Mushrooms to Genus III: Microscopic Features. Indiana University Mad River Press, 148 pp.

Manjula, B. (1983). A revised list of the Agaricoid and Boletoid basidiomycetes from India and Nepal. Proceedings of the Indian Academy of Sciences (Plant science) 92: 81–213.

Manoharachary, C., N.S. Atri, T. Prameela Devi, D. Kamil, S.K. Singh & A.P. Singh (2022). Bilgrami’s Fungi of India: List and References (1988-2020). Today & Tomorrow Printers and Publishers, New Delhi, 475 pp.

Natarajan, K., V. Kumaresan & K. Narayanan (2005). A checklist of Indian Agarics and Boletes (1984–2002). Kavaka 33: 61–128.

Natarajan, K. & B. Manjula (1982). South Indian Agaricales XVIII: Marasmius. Kavaka 10: 13–28.

Oliveira, J.J.S., J.M. Moncalvo, S. Margaritescu, & M. Capelari (2020). A morphological and phylogenetic evaluation of Marasmius sect. Globulares (Globulares-Sicci complex) with nine new taxa from the Neotropical Atlantic Forest. Persoonia-Molecular Phylogeny and Evolution of Fungi 44(1): 240–277.

Roy, N., D.K. Jha & A.K. Dutta (2022). A checklist of the macrofungi of North East India. Studies in Fungi 7: 1. https://doi.org/10.48130/SIF-2022-0001

Senthilarasu, G. & V. Kumaresan (2018). Mushroom Characterization: Part I – Illustrated Morphological Characteristics. Current Research in Environmental & Applied Mycology 8(5): 501–555. https://doi.org/10.5943/cream/8/5/3

Singer, R. (1986). The Agaricales in Modern Taxonomy, 4thedn. Federal Republic of Germany: Koeltz Scientific Books. Koenigstein, Germany, 981 pp.

Tamura, K., M. Nei & S. Kumar (2004). Prospects for inferring very large phylogenies by using the neighbor-joining method. Proceedings of the National Academy of Sciences of the United States of America 101(30): 11030–11035. https://doi.org/10.1073/pnas.0404206101

Tamura, K. & M. Nei (1993). Estimation of the number of nucleotide substitutions in the control region of mitochondrial DNA in humans and chimpanzees. Molecular Biology and Evolution 10: 512–526.

Tamura, K., G. Stecher & S. Kumar (2021). MEGA11: Molecular Evolutionary Genetics Analysis Version 11. Molecular Biology and Evolution 38(7): 3022–3027. https://doi.org/10.1093/molbev/msab120

Tan, Y.-S., D.E. Desjardin, B. A. Perry, S. Vikineswary & A. Noorlidah (2009). Marasmius sensu stricto in Peninsular Malaysia. Fungal Diversity 37: 9–100.

Thompson, J.D., D.G. Higgins & T.J. Gibson (1994). CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Research 22: 4673–4680.

Wannathes, N., D.E. Desjardin, K.D. Hyde, B.A. Perry & S. Lumyong (2009). A monograph of Marasmius (Basidiomycota) from Northern Thailand based on morphological and molecular (ITS sequences) data. Fungal Diversity 37: 209–306.

White, T.J., T.D. Bruns, S. Lee & J.W. Taylor (1990). Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics, pp. 315–322. In: Innis, M.A., D.H. Gelfand, J.J. Sninsky & T.J. White (eds). PCR Protocols: A Guide to Methods and Applications. Academic Press, Inc., New York

Wilson, A.W. & D.E. Desjardin (2005). Phylogenetic relationships in the gymnopoid and marasmioid fungi (Basidiomycetes, euagarics clade). Mycologia 97(3): 667–679. 

Zhang, M.Z., G.J. Li, R.C. Dai, Y.L. Xi, S.L. Wei & R.L. Zhao (2017). The edible wide mushrooms of Agaricus section Bivelares from Western China. Mycosphere 8(10): 1640–1652. https://doi.org/10.5943/ mycosphere/8/10/4