Journal of Threatened
Taxa | www.threatenedtaxa.org | 26 April 2024 | 16(4): 25103–25106
ISSN 0974-7907
(Online) | ISSN 0974-7893 (Print)
https://doi.org/10.11609/jott.8738.16.4.25103-25106
#8738 | Received 10 September 2023 | Final received 01 April 2024 |
Finally accepted 05 April 2024
First record of the phoretic association between Pediculaster
sp. (Pygmephoridae) mites and Musca crassirostris (Muscidae)
flies in India
Ramandeep Achint
1 & Devinder
Singh 2
1 School of Biosciences, RIMT
University, Mandi Gobindgarh, Punjab 147301, India.
2 Chandigarh University, NH-05,
Ludhiana - Chandigarh State Highway, Punjab 140413, India.
1 ramanbawa88@yahoo.com
(corresponding author), 2 devinder.ss.61@gmail.com
Editor: Kalpana Pai,
University of Pune, Pune, India. Date of publication: 26 April 2024
(online & print)
Citation: Achint, R. & D. Singh (2024). First record
of the phoretic association between Pediculaster sp. (Pygmephoridae)
mites and Musca crassirostris (Muscidae) flies in India. Journal of Threatened Taxa 16(4): 25103–25106. https://doi.org/10.11609/jott.8738.16.4.25103-25106
Copyright: © Achint & Singh 2024. Creative Commons Attribution 4.0 International
License. JoTT
allows unrestricted use, reproduction, and distribution of this article in any
medium by providing adequate credit to the author(s) and the source of
publication.
Funding: None.
Competing interests: The authors declare no competing interests.
Acknowledgements: We are grateful to Mr. Sarabjeet Singh, Dr Heo Chong
Chin and his master’s student Nurul Azmiera Binti Zamri from Universiti Teknologi MARA, Malaysia for helping with the
identification of mites.
The arthropods include many
classes; one of them is Arachnida, which is great and assorted as it contains
scorpions, spiders, ticks, and mites. It contains 1,14,275 species; among them
merely Acari has 55,214 species of mites and ticks
(Zhang 2013). In general, many small organisms exploit another larger organism
for their movement from one place to another which is usually called phoresy.
The word phoresy derives from the Greek phorein,
which means ‘to carry’ (White et al. 2017). According to Farish
& Axtell (1971), “Phoresy is a phenomenon in which one animal actively
seeks out and attaches to the outer surface of another animal for a limited
time during which the attached animal (termed the phoretic)
ceases both feeding and ontogenesis, such attachment presumably resulting in
dispersal from areas unsuited for further development, either of the individual
or its progeny”. In simple words, we can say that phoresy is the short-term
relation in which transportation takes the place of one animal by other animals.
In mites, long-distance dispersal is chiefly determined by phoresy, aerial
migration, and anemochory (dispersal by wind) (Szymkowiak
et al. 2007).
The phenomenon of phoresy has
been pragmatic in many organisms, be it flies & mites, flies & ticks,
beetles & bees, nematodes & flies/slugs, and bugs & mantids (White
et al. 2017). An examination of a specific phoront on
a carrion can authenticate the existence of its carrier even when the carrier
is absent. Fast colonised mites have developed unique behaviours in which they
have become phoront to flies for mobility and
dispersal (Athias-Binche 1994; Siepel
1994). Upon reaching their preferred habitat, such as a corpse or other
biological waste, the mites detach from the carrier and commence the process of
maturing into their reproductive stage (Halliday 2000). Berlese (1918) was the
first to report on phoretic mites found on carcasses.
In this article, the description of a phoretic pygmephorid mite on a muscid fly
in India marks its initial documentation. Pygmephorid
mites fall under the order Prostigmata and the family
Pygmephoridae.
Thirty-two mites were collected
in July 2019 from Khajjiar town, which is located at
32.55580N, 76.06560E with 1,920 m elevation in the Chamba district of Himachal Pradesh, India. Collected mites
were present on the muscid flies that were captured
by a collection net from the bird corpse (Acridotheres
tristis). Subsequently, collected flies along
with mites were stored in the 70% alcohol. Mites were then detached from the
flies with the help of forceps and cleared in lactophenol solution (for 48
hours). Slides of mites were mounted with Hoyer’s medium. Afterward,
photography was done with the help of the micro photographic unit (Leica,
DM4000 B LED) in the Sophisticated Instrumentation Centre of Punjabi
University, Patiala. Mites were identified with the help of keys given by
Krantz & Walter (2009) and fly species by Emden (1965). Fly species were
further confirmed with the help of molecular techniques by amplifying the
mitochondrial DNA COI (Barcoding) region. The type material was deposited in
the collection of the Department of Zoology and Environmental Sciences, Punjabi
University, Patiala.
Mites were identified as species
of the genus Pediculaster belonging to the
family Pygmephoridae. Image 1 shows adults of Pediculaster sp. mites attached to the prothorax region of Musca
crassirostris fly; Image 2 shows adults of Pediculaster sp.; Image 3 shows a close view of the gnathosoma part of the mite; and Image 4 shows a close view
of the idiosoma part of the mite.
The flies were recognized as Musca crassirostris, a member of the Muscidae family.
Additionally, using LCO/HCO primers provided by Folmer et al. (1994), the mitochondrial COI gene (Folmer area) has been amplified to guarantee the identification of fly species.
For sequencing purposes, amplified DNA was delivered to the Agrigenome labs.The species Musca crassirostris was validated by BLAST analysis of the sequence acquired after sequencing in the NCBI database.Upon submission of the sequence to the NCBI database, a distinct accession number, MH243421, was obtained (Table 1).It was the first instance of a phoretic connection between Pediculaster mites and Musca crassirostris.
Various muscid
species were recognised as a carriers for the Pediculaster mites Kheradmand
et al. (2006) recorded that Pediculaster fletchmanni mites used Musca domestica
as a carrier. Camerik & Coetzee (1998) examined
that Pediculaster corpridis
mites attached to Musca confiscate for their dispersal. Masan & Kristofik (1992) described that Pediculaster
mesembriane mites used Fannia
manicata flies for phoresy. Cheyletus
eruditus & Ereynetes
which are members of prostigmatic mites used Muscidae flies along with Lepidopteran as carriers.
Astigmatic mite species are used as well as muscid flies for their dispersal. Flies belonging to family
Histiostomatidae like Copronomoia
sphaerocerae, Histiostoma
muscae, Myianoetus
diadematus, Myianoetus
ovatus, Myianoetus
parvus, Myianoetus
muscarum, Myianoetus
longisetosus (Masan & Kristofık
1992; Chinniah & Mohanasundaram
1995; Greenberg & Carpenter 1960; Greenberg 1961) and family Winterschmidtiidae like Vidia
sp. (Ho 1990) used muscid
flies as a carrier for the dispersion.
In company with Asitgmatic types mites, Mesostigmatic mites also used Muscid
flies for phoresy as well. Numerous mites species belonging to Macrochelidae family like Glyptholaspis
confusa used Musca domestica
(Niogret et al. 2006); Macrocheles
bertrandi used Stomoxys
calcitrans (Niogret
& Nicot 2008);
Macrocheles glaber
used Hydrotaea dentipes
(Masan & Kristofik 1992); Macrocheles
muscaedomesticae used Musca domestica (Pereira & Castro 1947) and Musca sorbens along with Ophyra
chalcogaster (Ho 1990);
Macrocheles mykytowyczi
used many species of Muscid flies (Halliday 2000); Macrocheles ovoidalis
used Stomoxys calcitrans
(Niogret & Nicot 2008);
Macrocheles perglaber
used Musca domestica (Niogret
et al. 2006); Macrocheles robustulus used Musca domestica
(Axtell 1964); Macrocheles subbadius used Stomoxys
calcitrans, Musca domestica,
Haematobia irritans
(Axtell 1964; Krantz & Whitaker 1988; Niogret et
al. 2006) as a carrier. A few mites belonging to the Parasitidae
family which includes Gamasodes spiniger exploit Hydotaea
species as carriers. Uroseius sp. and Halolaelaps sp. species of families Trachytidae and Halolaelapidae
employ Musca domestica, Musca stabulans, and Hydrotaea
dentipes as dispersal carriers (Masan & Kristofik 1992; Perotti 1998).
The present study is the first of
its kind in India but it needs to be done to a great
extent directly to compile data about the species exactitude of mites and their
habitat penchant. If knowledge about the carriers, life cycles, behaviour, and
habitat particulars of mites is acquired then it will help in estimating the postmortem interval (PMI). Forensic acarology should
formulate superior exploit of this and hastily expand into a helpful alternate
input into forensic analysis.
Table 1. Musca crassirostris fly sequence submitted to the NCBI.
>MH243421
TTTGGAGCATGATCTGGTATAGTAGGAACTTCATTAAGAATTTTAATTCGAGCCGAATTAGGACACCCTGGTGCTTTAATTGGTGACGATCAAATTTATAATGTTATTGTAACAGCTCATGCTTTTATTATAATTTTCTTTATAGTTATGCCTATTATAATTGGAGGATTTGGAAATTGATTAGTTCCTTTAATGTTAGGAGCTCCTGATATAGCATTTCCTCGAATAAATAATATAAGTTTCTGACTTTTACCTCCTGCTCTTACTTTATTATTAGTTAGAAGTATAGTAGAAAAGGGGGCTGGGACAGGATGAACAGTTTATCCACCTTTATCTTCAATTATTGCTCATGGAGGGGCTTCTGTTGATTTAGCTATTTTTTCTCTTCATTTAGCCGGAATTTCTTCAATTTTAGGAGCAGTAAATTTTATTACTACTGTAATTAATATACGAGCTACTGGAATTACATTTGATCGAATACCTTTATTTGTATGATCAGTTGTAATTACTGCTTTATTACTTTTACTTTCTTTACCAGTTTTAGCCGGAGCTATTACTATACTATTAACAGATCGAAATTTAAATACTTCGTTCTTTGACCCAGCAGGAGGAGGTGA
FOR
IMAGES - - CLICK HERE FOR FULL PDF
References
Athias-Binche, F. (1994). La phore´sie
chez les acariens – aspects adaptatifs
et evolutifs [Phoresy in acarina-
adaptive and evolutionary aspects]. Editions du Castillet,
Perpignan.
Axtell, R.C. (1964). Phoretic
relationship of some common manure-inhabiting Macrochelidae
(Acarina: Mesostigmata) to
the house fly. Annals of the Entomological Society of America 57:
584–587.
Berlese, A. (1918). Centuria
quarta di Acari nuovi. Redia 13: 113–190.
Camerik, A.M. & S.H. Coetzee (1998). Phoretic
females of two new species of the genus Pediculaster
(Acari: Pygmephoridae) from
cattle dung in South Africa. International Journal of Acarology 24:
21–31.
Chinniah, C. & M. Mohanasundaram
(1995). Four new
species of histiostoma associated with insects in
Tamil Nadu. Entomon 20: 73–78.
Emden, F.I. (1965). The Fauna of India and the
adjacent countries, Diptera, Muscidae,
7(I). Government of India, New Delhi, 647 pp.
Farish, D.J. & R.C. Axtell (1971). Phoresy redefined and examined
in Macrocheles muscae domesticae (Acarina: Macrochelidae). Acarologia
13: 16–29.
Folmer, O., M. Black, W. Hoeh, R. Lutz & R. Vrijenhoek
(1994). DNA primers
for amplification of mitochondrial cytochrome c oxidase subunit I from diverse
metazoan invertebrates. Molecular Marine Biology and Biotechnology 3(5):
294–299.
Greenberg, B. (1961). Mite orientation and survival on
flies. Nature 190: 107–108.
Greenberg, B. & P.D.
Carpenter (1960). Factors in phoretic association of a mite and
fly. Science 132: 738–739.
Halliday, R.B. (2000). The Australian species of Macrocheles (Acarina: Macrochelidae). Invertebrate Systematics 14:
273–326.
Ho, T.M. (1990). Phoretic
association between Macrocheles muscaedomesticae
(Acari: Macrochelidae) and
flies inhabiting poultry manure in Peninsular Malaysia. Experimental and
Applied Acarology 10: 61–68.
Kheradmand, A.K., K. Kamali
& Y. Fathipour (2006). Biology and life table
parameters of the mushroom pest, Pediculaster fletchmanni (Acari: Siteroptidae), at three constant temperatures. Journal of
Insect Science 13: 375–380.
Krantz, G.W. & J.O. Whitaker
(1988). Mites of the
genus Macrocheles (Acari: Macrochelidae) associated with small mammals in North
America. Acarologia 29: 225–259.
Krantz, G.W. & D.E. Walter
(2009). A Manual
of Acarology. Third Edition. Texas Tech University Press, Lubbock, Texas,
807 pp.
Masan, P. & J. Kristofık (1992). Phoresy of some arachnids (Acarina and Pseudoscorpionidea)
on synanthropic flies (Diptera)
in the South Slovakia. Biologia 47: 87–96.
Niogret, A. & J. Nicot
(2008). Combined
approach using morphology and its sequences for description of three new
species of Macrocheles (Acari:
Macrochelidae). Zootaxa
1873(1): 39–49. https://doi.org/10.11646/zootaxa.1873.1.4
Niogret, J., J.P. Lumaret
& M. Bertrand (2006). Review of the phoretic association between
coprophilous insects and macrochelid mites (Acari: Mesostigmata) in France. Elytron 20: 99–121.
Pereira, C. & M.P. Castro
(1947). Forese e partenoge´nese arreno´toca em ‘Macrocheles muscaedomesticae (Scopoli)’ (Acarina: Macrochelidae) e sua significacao ecolo´gica [Phoresy
and arrhenotokous parthenogenesis in Macrocheles muscaedomesticae (Scopoli) (Acarina: Macrochelidae) and its
ecological importance]. Arch Inst Biol (Sao
Paulo) 18: 71–89.
Perotti, M.A. (1998). Interacciones
entre a´caros (depredadores
y fore´ticos) y dı´pteros muscoideos (presas y forontes) en ha´bitats
rurales y suburbanos de la pendiente atla´ntica bonaerense [Predatory and phoretic
interactions between mites and flies in the Argentinean pampas (ecology and
physiology)] Facultad de Ciencias
Exactas y Naturales. Universidad Nacional de Mar del
Plata - PhD thesis, Mar del Plata. 126 pp.
Siepel, H. (1994). Life-history tactics of soil
microarthropods. Biology and Fertility of Soils 18: 263–278.
Szymkowiak, P., V. Gorski & D. Bajerlein (2007). Passive dispersal in arachnids. Biology
Letters 4: 75–101.
White, P.S., L. Morran
& J. de Roode (2017). Phoresy. Current Biology
27(12): R578–R580. https://doi.org/10.1016/j.cub.2017.03.073
ZHANG, Z.Q. (2013). Phylum Athropoda.
In: Zhang, Z.Q. (ed.). Animal
biodiversity: an outline of higher-level classification and survey of taxonomic
richness (Addenda 2013). Zootaxa
3703(1): 17. https://doi.org/10.11646/zootaxa.3703.1.6