Journal of Threatened
Taxa | www.threatenedtaxa.org | 26 December 2022 | 14(12): 22215–22220
ISSN 0974-7907 (Online) | ISSN 0974-7893
(Print)
https://doi.org/10.11609/jott.7960.14.12.22215-22220
#7960 | Received 08 April 2022 | Final
received 08 August 2022 | Finally accepted 19 November 2022
New distribution record and DNA
barcoding of Sapria himalayana
Griff. (Rafflesiaceae), a rare and endangered holoparasitic plant from Mizoram, India
Laldinfeli Ralte
1, Hmingremhlua Sailo
2, Sagolshem Priyokumar
Singh 3, Laldinliana Khiangte
4 & Y. Tunginba Singh 5
1–5 Laboratory of Molecular Ecology
and Genetics, Department of Botany, Mizoram University, Tanhril,
Aizawl, Mizoram 796004, India.
1 lucylaldinfeli39@gmail.com, 2
hmingremhlua94@gmail.com, 3 priyosagolshem@gmail.com, 4 eleda.kh@gmail.com,
5 tunginba@mzu.edu.in (corresponding author)
Editor: Vijayasankar Raman, University of Mississippi, USA. Date of publication: 26 December
2022 (online & print)
Citation: Ralte,
L., H. Sailo, S.P. Singh, L. Khiangte
& Y.T. Singh (2022). New distribution record and DNA
barcoding of Sapria himalayana
Griff. (Rafflesiaceae), a rare and endangered holoparasitic plant from Mizoram, India. Journal of Threatened Taxa 14(12): 22215–22220. https://doi.org/10.11609/jott.7960.14.12.22215-22220
Copyright: © Ralte
et al. 2022. Creative Commons Attribution
4.0 International License. JoTT allows unrestricted use, reproduction, and
distribution of this article in any medium by providing adequate credit to the
author(s) and the source of publication.
Funding: None.
Competing interests: The authors
declare no competing interests.
Author details: Laldinfeli Ralte is a CCRAS post-doctoral
fellow at the Department of
Botany, Mizoram University,
Aizawl, Mizoram. She is interested in the bioprospecting of natural products from underutilized plants. Hmingremhlua Sailo is a
PhD student at the Department
of Botany, Mizoram
University. Sagolshem Priyokumar Singh
is a PhD student at the Department
of Botany, Mizoram
University. Laldinliana Khiangte is a
PhD student at the Department
of Botany, Mizoram
University. Y. Tunginba Singh
is a professor at the Department
of Botany, Mizoram
University. He is interested in the
molecular genetics studies
of rare and endangered
species.
Author contributions: LR—data collection,
data handling, data curation, writing,
review and editing of manuscript; HS—writing, review, and editing of
manuscript;
SPS—review, and
editing of manuscript; LK—statistical analysis; YTS—supervision, review, and editing
of the manuscript.
Acknowledgements: Laldinfeli Ralte
thanks Central Council for Research in Sciences (CCRAS), Ministry of Ayush, Government of India for a Post
Doctoral fellowship, Hmingremhlua Sailo thanks University Grants Commission, Government of
India for a National Fellowship for Higher Education for Schedule Tribe
Students (NFST), Sagolshem Priyokumar
Singh and Laldinliana Khiangte
thank University Grants Commission, Government of India for UGC-MZU Doctoral
fellowship. The authors are also grateful to Mr H. Vanlalnunhlima
for providing the plant materials.
Abstract: Sapria himalayana Griff. is a rare and endangered holoparasitic plant that prefers a specific host (Tetrastigma sp.). It is one of the lesser-known and
poorly understood plants facing threats of extinction owing to human
interference in the evergreen forests of Mizoram. The flower is the only
visible part of this endophyte and blooms from November to December. The plant
was encountered for the first time in the evergreen forest near Rullam village in the Serchhip
District of Mizoram, India. In the present study, DNA barcoding was used to
identify the plants, and the internal transcribed spacer 2 (ITS2) region
of S. himalayana was amplified and
sequenced. The ITS2 sequence could accurately identify up to the species
level for this endangered species. The absence of the ribulose-biphosphate carboxylase gene (rbcL)
region in the genome supports its holoparasitic
nature. Hence, DNA barcoding can help in taxonomic and biodiversity research
and aid in selecting taxa for various molecular ecology and population genetics
studies. The phylogenetic tree was analyzed using the maximum-likelihood
method, and our findings showed that species from different families were
clearly discriminated in a phylogenetic tree. To the best of our knowledge,
this is the first report of DNA barcoding using ITS2 region of S.
himalayana from Mizoram, India.
Keywords: DNA barcoding, endangered species,
endophyte, holoparasitic, ITS2, Mizoram, Sapria himalayana.
INTRODUCTION
Angiosperms, commonly known as
flowering plants, are the most diverse group of land plants, and this group
also includes parasitic plants. Parasitic plants lack chlorophyll and depend on
the host plants for water and nutrition (Osathanunkul
2019). Rafflesiaceae comprises holoparasitic
plants (Rubiales et al. 2011) and includes three genera, namely Rafflesia (28 species), Rhizanthes
(four species) and Sapria (three species) (Trần et al. 2018). Sapria
himalayana Griff. (Rafflesiaceae)
is also a holoparasite with a preference for specific
hosts- Tetratstigma species (Elliott
1990).
Sapria himalayana
consists of
endophytic vegetative tissues with microscopic strands called haustoria,
ramifying through the root cambium of the host plant. The flowers (Image 1A) are
about 20 cm across, bright red and mottled with yellow spots. They appear above
the ground, emitting a putrid odour. The flowers
usually remain in bloom for two---three days and eventually decompose. The
flowering stalks are short, erect and unbranched. The flower buds (Image 1B)
are globose and covered basally by light pink bracts. The fruit is swollen,
blackish-brown, and crowned with perianth remnants. The flowering and fruiting
of S. himalayana occur during
winter, usually during December-February. The seeds have been reported to be
the size of grapes and blackish-brown in colour
(Borah & Ghosh 2018).
Sapria himalayana
has been
reported to have a preference for specific hosts, so the removal of the host
plants might eventually result in the death of this parasitic plant (Osathanunkul 2019). In addition, fragmentation and loss of
habitat, intensive agriculture to meet human needs and other anthropogenic
activities threaten the existence of this holoparasitic
plant (Osathanunkul 2019). Apart from biodiversity
conservation, accurate taxonomic assignment is important for this rare species
as it may be accidentally collected, adding to the threat of its existence.
Traditionally, the taxonomic
assignment has mainly been the responsibility of taxonomic experts (Yang et al.
2018). Above that, population genetic studies are also restricted because of
their limited distribution (Elliott 1990). DNA barcoding using nucleotide
comparisons of approved gene regions allows simple, rapid and reliable
identification of species (Cosaic et al. 2016; Saddhe & Kumar 2018). The internal transcribed spacer
Two (ITS2) region of nuclear ribosomal DNA is considered one of the
candidate DNA barcodes since it has several desirable characteristics,
including conserved regions for designing universal primers, ease of
amplification, and adequate variability, to distinguish even closely related
species (Kang et al. 2017).
Global distributions of S.
himalayana have been reported from Myanmar,
northeastern India, southeastern Tibet, Thailand and Vietnam (Elliott 1990; Hajra 1996). In India, William Griffith first reported S.
himalayana in 1847 from the tropical wet
evergreen forests of Mishmi Hills of Lohit District
in Arunachal Pradesh. Since then, S. himalayana
has also been reported from Assam, Manipur, and Meghalaya (Borah &
Ghosh 2018; Ahmad et al. 2020). In Mizoram, S. himalayana
was first reported by Lakshminarasimhan et al.
(2013) from Tawi Wildlife Sanctuary in Aizawl,
Mizoram. However, no molecular analysis has been undertaken thus far on S.
himalayana plants found in Mizoram.
Recently, S. himalayana was spotted in an evergreen forest near Rullam village in Serchhip
District of Mizoram, India. The plant is locally called ‘lei pangpar,’ meaning flower without a stalk. This study aimed,
for the first time, to identify S. himalayana
using DNA barcoding combined with morphological characterization. The genome of
S. himalayana collected from Thailand
has recently been published by Cai et al. (2021). However, to our knowledge,
DNA barcoding of Indian materials of this rare species has not been conducted
so far.
MATERIALS AND METHODS
Study area
Flowering buds of Sapria himalayana
were collected from an evergreen forest near Rullam
village in Serchhip District, Mizoram, India (Figure
1). The locality has an average elevation of 888 m and is situated at 23.44oN
& 92.99 oE. The annual daily average
temperature ranges 15–27 oC with moderate
rainfall.
Collection of samples and
Isolation of DNA
The samples were found attached
to the roots of Tetrastigma species (T.
obovatum Gagnep,
T. pachyphyllum (Hemsl.) Chun, T. cruciatum
Craib & Gagnep).
The collected samples were brought to the Department of Botany, Mizoram
University, for further investigation. Isolation of genomic DNA was done using
the standard CTAB method (Doyle & Doyle 1990) with some modifications.
Briefly, 200 mg of two flower buds was ground and analysed
separately using a sterile mortar and pestle with 500 µl of extraction buffer
(100 mM TrisHCl, 1.4M NaCl, 2 mmM EDTA, 2% CTAB, 1% PVP
at pH 8), and incubated at 600C for 30 mins followed by
centrifugation at 11,000 rpm for 15 mins. After RNase A treatment, the sample
was incubated at 300C for 30 mins. Then, 500 µL Chloroform Isoamyl
was added to the sample and centrifuged at 11,000 rpm for 1 min. A 0.7 volume
of ice-cold isopropanol was added to precipitate the genomic DNA at -200C.
The DNA was washed with 70% ethanol and dissolved in 30 µL TE buffer (10 mM TrisHCl, 1 mM
EDTA).
Amplification of DNA, sequencing
and analysis
The isolated DNA was amplified
using ITS2 primers: F – GAAGGAGAAGTCGTAACAAGG, R – TCCTCCGCTTATTGATATGC
and rbcL primers: F- CTGTATGGACCGATGGACTTAC,
R-CGGTGGATGTGAAGAAGTAGAC (Zahra et al.
2016) in a Veriti 96-Well Thermal Cycler
(ABI, Thermo Fisher Scientific).
The amplified DNA products were
cleaned and sent for commercial sequencing to AgriGenome
(Cochin, India). The resultant sequence was analyzed using NCBI BLAST
(ncbi.nlm.gov), and the similarity indices with the reference sequences from
GenBank database were used for the species identification of the samples.
Phylogenetic analysis
A phylogenetic tree was
constructed in MEGA X (Kumar et al. 2018) using the maximum likelihood (ML)
method. The model suggested by Bayesian information Criterion (BIC) was T92 +
G, with the lowest BIC score. The models with the lowest BIC scores were
considered to describe the best substitution pattern (Posada & Crandall
2001). The phylogenetic tree was constructed using similar sequences identified
from BLASTn analysis from Genbank.
Species of closely related families from the same order (Malpighiales)-
Euphorbia canariensis (Euphorbiaceae),
Chaetocarpus echinocarpus
(Peraceae) were also used, and a non-photosynthetic
plant Conopholis americana
(Orobanchaceae) was taken as an outgroup. Only when
conspecific and congeneric species in the study formed a single clade with
bootstrap P >50, the ML tree was considered successful.
RESULT AND DISCUSSION
Morphological characters of S.
himalayana and the host plant
Sapria himalayana
flowers and
flower-buds were found growing on the roots of T. cruciatum.
(Vitaceae). The host plant had leaves with tendrils
arising from the bases of the petioles.
The collected flowers of S.
himalayana (Image 1) were dark-red,
mottled with yellowish-white dots, and had a bowl-shaped disk. Leaves were
absent. The flowering occurs during winter, from November to February.
DNA - Isolation, Amplification,
Sequencing and Analysis
The genomic DNA from S. himalayana was successfully isolated and
amplified using ITS2 primer (Image 2). However, the rbcL
primer failed to amplify the DNA.
The amplified DNA of S. himalayana was subjected to sequencing and the
sequence was submitted to the GenBank database (MW788913). The amplicon (731 bp) also showed a high percentage similarity (97.44%) with
the reference sequence (EU882286) from GenBank database.
Phylogenetic analysis
The ML-based phylogenetic tree of
ITS2 showed high bootstrap values, and species of each genus were
clustered on different branches and nodes as monophyletic taxon and clustered
with the genus of other clades. The taxonomic units were statistically branched
from their nodes with bootstrap P >70 for most of the sub-trees. Thus, the
present study revealed that ITS2 had a high-resolution potential for the
molecular taxonomy of S. himalayana.
The collected sample was clustered together with other Sapria
species. Here, S. himalayana formed
a monophyletic group (bootstrap value = 100), and S. himalayana
individuals showed coalescent stochasticity with high branch support value
(bootstrap value = 100) (Figure 2) while other species were grouped into a
different clade. Our study showed that the species from different families were
discriminated clearly in a phylogenetic tree. Therefore, ITS2
locus-based ML phylogenetic tree can be used to identify unknown samples for
molecular taxonomy and identification of rare and endangered species.
The identification and
classification of plants based on their morphological characteristics are an
integral part of taxonomy; however, identifying plants based on their
morphology alone may sometimes be inaccurate (Feng et al. 2017). DNA barcoding
is a valuable taxonomic tool for the identification of species. A study was
conducted to identify S. himalayana from
Thailand using ITS2 employing environmental DNA (eDNA) (Osathanunkul 2019). In our study, DNA barcoding of S.
himalayana gDNA was successfully done
using ITS2 primers, resulting in a 97.44% similarity with the reference
sequences from the GenBank database; this confirms the identification of the
studied plant sample. Another interesting observation was the failure to
amplify the rbcL region of the species; this
could be primarily due to heavy gene loss, including the plastid genome, as
already reported for the genus Sapria (Cai
et al. 2021) and hence loss of its photosynthetic activity. Thus, DNA barcoding
can help derive an accurate phylogenetic classification. Therefore, the
identification and classification of plants based on their morphology and DNA
complement each other to attain accurate species identification.
CONCLUSION
Sapria himalayana,
a rare and endangered holoparasitic plant, was
collected from Mizoram. The results of DNA barcoding confirms the
identification of this species. However, the distribution of this little known
taxon is highly restricted in the region. This study suggests that focused
explorations must be conducted in similar habitats to assess the population
size. Suitable conservation measures are needed to protect this rare and
interesting species from threat of extinction from the region.
Table 1. Flower description of Sapria himalayana.
|
Floral parts |
Size |
|
Flower |
8 cm high; 14.5–15.5 cm in
diameter |
|
Outer Perigone Lobes |
3.5–4.5 cm long; 3–4 cm wide |
|
Inner Perigone Lobes |
2.5–3 cm long; 2–2.5 cm wide |
|
Disk |
3.5–4 cm in diameter |
|
Host Plant’s Root |
1–2 cm in diameter |
For figures &
images - - click here for full PDF
REFERENCES
Ahmad, A., A.
Kumar, S.G. Rawat & G.V. Gopi (2020). Recent record of a threatened holoparasitic plant Sapria
himalayana Griff. in Mehao
wildlife Sanctuary, Arunachal Pradesh, India. Journal of Threatened Taxa
12(10): 16399–16401. https://doi.org/10.11609/jot.5168.12.10.16399-16401
Borah, D.
& D. Ghosh (2018). Sapria himalayana. Resonance 23(4):
479–489.
Cai, L., B.J.
Arnold, Z. Xi, D.E. Khost, N. Patel, C.B. Hartmann,
S. Manickam, S. Sasirat, L.A. Nikolov,
S. Mathews, T.B. Sackton & C.C. Davis (2021). Deeply altered genome architecture
in the endoparasitic flowering plant Sapria himalayana
Griff. (Rafflesiaceae). Current Biology 31:
1002–1011.
Cosaic, E, P.M. Hollingsworth, S.
Lavergne & P. Taberlet (2016). From barcodes to genomes:
Extending the concept of DNA barcoding. Molecular Ecology 25: 1423–1428.
Doyle, J.J.
& J.J. Doyle (1990). Isolation of plant DNA drom fresh tissue. Focus
12: 13-15.
Elliott, S.
(1990). The
distribution, status and ecology of Sapria himalayana Griff. (Rafflesiaceae)
in Thailand. The Bulletin of British Ecological Society 11:
246–248.
Feng, S., K.
Jiao, Y. Zhu, H. Wang, M. Jiang & H. Wang (2017). Molecular identification of Physalis species (Solanaceae) using a candidate DNA
barcode: the chloroplast psbA-trn H intergenic
region. Genome 61: 15–2.
Hajra, P.K. (1996). A Contribution to the Flora
of Namdapha, Arunachal Pradesh. Botanical Survey
of India, Kolkata, India, 476 pp.
Kang, Y., Z.
Deng, R. Zang & W. Long (2017). DNA barcoding analysis analysis and phylogenetic relationship of tree species in
tropical cloud forests. Scientific Report 7(1): 1–9. https://doi.org/10.1038/
s41598-017-13057-0.
Kumar, S., G.
Stecher, M. Li, C. Knyaz
& K. Tamura (2018). MEGA X: molecular evolutionary genetics analysis across computing
platforms. Molecular Biology and Evolution 35(6): 1547–1549.
Lakshminarasimhan, P., W. Arisdason,
S. Bandyopadhyay, T.K. Paul, E.N.V.I.S. Team, S. Gantait,
T. Chakrabortty, S. Nandi, D.E. Operator, M.K. Das &
N.P. Balakrishnan (2013). “Sapria himalayana
(Rafflesiaceae) from Mizoram”. Envis
Newsletter 18(1): 2.
Osathanunkul, M. (2019). eDNA-based monitoring of
parasitic plant (Sapria himalayana). Scientific
Reports 9(1): 1–5. https://doi.org/10/1038/s41598-019-45647-5
Posada, D.,
& K.A. Crandall (2001). Selecting the best-fit model of
nucleotide substitution. Systematic Biology 50(4): 580–601.
Rubiales,
J.M., L. Hernández, F. Romero & C. Sanz (2011). The use of forest resources in
central Iberia during the Late Iron Age. Insights from the wood charcoal
analysis of Pintia, a Vaccaean
oppidum. Journal of Archaeological Science 38(1): 1–10. https://doi.org/10.1002/9780470015902.a0021271
Saddhe, A.A. & K. Kumar (2018). DNA barcoding of plants:
selection of core markers for taxonomic groups. Plant Science Today 5(1):
9–13.
Trần, H.Đ., H.T. Lưu,
Q.Đ. Nguyễn, H.C. Nguyễn,
P. Athen & K.M. Wong (2018). Identification, sexual
dimorphism and aspects of the natural history of Sapria
himalayana (Rafflesiaceae)
on Vietnam’s Lang Biang Plateau. Botanical
studies 59(1): 1–10.
Yang, F., F.
Ding, H. Chen, M. He, S. Zhu, X. Ma, J. Li & H. Li (2018). DNA barcoding for the
identification and authentication of animal species in traditional
medicine. Evidence-Based Complementary and Alternative Medicine. https://doi.org/10.1155/2018/5160254
Zahra, N.B., Z.K. Shinwari & M. Qaiser (2016). DNA barcoding: a
tool for standardization of herbal medicinal products (HMPS) of Lamiaceae from Pakistan. Pakistan Journal of Botany
48: 2167–2174.