Journal of Threatened Taxa | www.threatenedtaxa.org | 26 December 2022 | 14(12): 22215–22220

 

 

ISSN 0974-7907 (Online) | ISSN 0974-7893 (Print) 

https://doi.org/10.11609/jott.7960.14.12.22215-22220

#7960 | Received 08 April 2022 | Final received 08 August 2022 | Finally accepted 19 November 2022

 

 

 

New distribution record and DNA barcoding of Sapria himalayana Griff. (Rafflesiaceae), a rare and endangered holoparasitic plant from Mizoram, India

 

Laldinfeli Ralte 1, Hmingremhlua Sailo 2, Sagolshem Priyokumar Singh 3, Laldinliana Khiangte 4 & Y. Tunginba Singh 5

 

1–5 Laboratory of Molecular Ecology and Genetics, Department of Botany, Mizoram University, Tanhril, Aizawl, Mizoram 796004, India.

1 lucylaldinfeli39@gmail.com, 2 hmingremhlua94@gmail.com, 3 priyosagolshem@gmail.com, 4 eleda.kh@gmail.com, 5 tunginba@mzu.edu.in (corresponding author)

 

 

 

Editor: Vijayasankar Raman, University of Mississippi, USA.       Date of publication: 26 December 2022 (online & print)

 

Citation: Ralte, L., H. Sailo, S.P. Singh, L. Khiangte & Y.T. Singh (2022). New distribution record and DNA barcoding of Sapria himalayana Griff. (Rafflesiaceae), a rare and endangered holoparasitic plant from Mizoram, India. Journal of Threatened Taxa 14(12): 22215–22220. https://doi.org/10.11609/jott.7960.14.12.22215-22220

 

Copyright: © Ralte et al. 2022. Creative Commons Attribution 4.0 International License.  JoTT allows unrestricted use, reproduction, and distribution of this article in any medium by providing adequate credit to the author(s) and the source of publication.

 

Funding: None.

 

Competing interests: The authors declare no competing interests.

 

Author details: Laldinfeli Ralte is a CCRAS post-doctoral fellow at the Department of Botany, Mizoram University, Aizawl, Mizoram. She is interested in the bioprospecting of natural products from underutilized plants.  Hmingremhlua Sailo is a PhD student at the Department of Botany, Mizoram University.  Sagolshem Priyokumar Singh is a PhD student at the Department of Botany, Mizoram University. Laldinliana Khiangte is a PhD student at the Department of Botany, Mizoram University.  Y. Tunginba Singh is a professor at the Department of Botany, Mizoram University. He is interested in the molecular genetics studies of rare and endangered species.

 

Author contributions: LR—data collection, data handling, data curation, writing, review and editing of manuscript; HS—writing, review, and editing of manuscript;

SPS—review, and editing of manuscript; LK—statistical analysis; YTS—supervision, review, and editing of the manuscript.

 

Acknowledgements: Laldinfeli Ralte thanks Central Council for Research in Sciences (CCRAS), Ministry of Ayush, Government of India for a Post Doctoral fellowship, Hmingremhlua Sailo thanks University Grants Commission, Government of India for a National Fellowship for Higher Education for Schedule Tribe Students (NFST), Sagolshem Priyokumar Singh and Laldinliana Khiangte thank University Grants Commission, Government of India for UGC-MZU Doctoral fellowship. The authors are also grateful to Mr H. Vanlalnunhlima for providing the plant materials.

 

 

 

Abstract: Sapria himalayana Griff. is a rare and endangered holoparasitic plant that prefers a specific host (Tetrastigma sp.). It is one of the lesser-known and poorly understood plants facing threats of extinction owing to human interference in the evergreen forests of Mizoram. The flower is the only visible part of this endophyte and blooms from November to December. The plant was encountered for the first time in the evergreen forest near Rullam village in the Serchhip District of Mizoram, India. In the present study, DNA barcoding was used to identify the plants, and the internal transcribed spacer 2 (ITS2) region of S. himalayana was amplified and sequenced. The ITS2 sequence could accurately identify up to the species level for this endangered species. The absence of the ribulose-biphosphate carboxylase gene (rbcL) region in the genome supports its holoparasitic nature. Hence, DNA barcoding can help in taxonomic and biodiversity research and aid in selecting taxa for various molecular ecology and population genetics studies. The phylogenetic tree was analyzed using the maximum-likelihood method, and our findings showed that species from different families were clearly discriminated in a phylogenetic tree. To the best of our knowledge, this is the first report of DNA barcoding using ITS2 region of S. himalayana from Mizoram, India.

 

Keywords: DNA barcoding, endangered species, endophyte, holoparasitic, ITS2, Mizoram, Sapria himalayana.

 

 

 

 

INTRODUCTION

 

Angiosperms, commonly known as flowering plants, are the most diverse group of land plants, and this group also includes parasitic plants. Parasitic plants lack chlorophyll and depend on the host plants for water and nutrition (Osathanunkul 2019). Rafflesiaceae comprises holoparasitic plants (Rubiales et al. 2011) and includes three genera, namely Rafflesia (28 species), Rhizanthes (four species) and Sapria (three species) (Trần et al. 2018). Sapria himalayana Griff. (Rafflesiaceae) is also a holoparasite with a preference for specific hosts- Tetratstigma species (Elliott 1990).

Sapria himalayana consists of endophytic vegetative tissues with microscopic strands called haustoria, ramifying through the root cambium of the host plant. The flowers (Image 1A) are about 20 cm across, bright red and mottled with yellow spots. They appear above the ground, emitting a putrid odour. The flowers usually remain in bloom for two---three days and eventually decompose. The flowering stalks are short, erect and unbranched. The flower buds (Image 1B) are globose and covered basally by light pink bracts. The fruit is swollen, blackish-brown, and crowned with perianth remnants. The flowering and fruiting of S. himalayana occur during winter, usually during December-February. The seeds have been reported to be the size of grapes and blackish-brown in colour (Borah & Ghosh 2018).

Sapria himalayana has been reported to have a preference for specific hosts, so the removal of the host plants might eventually result in the death of this parasitic plant (Osathanunkul 2019). In addition, fragmentation and loss of habitat, intensive agriculture to meet human needs and other anthropogenic activities threaten the existence of this holoparasitic plant (Osathanunkul 2019). Apart from biodiversity conservation, accurate taxonomic assignment is important for this rare species as it may be accidentally collected, adding to the threat of its existence.

Traditionally, the taxonomic assignment has mainly been the responsibility of taxonomic experts (Yang et al. 2018). Above that, population genetic studies are also restricted because of their limited distribution (Elliott 1990). DNA barcoding using nucleotide comparisons of approved gene regions allows simple, rapid and reliable identification of species (Cosaic et al. 2016; Saddhe & Kumar 2018). The internal transcribed spacer Two (ITS2) region of nuclear ribosomal DNA is considered one of the candidate DNA barcodes since it has several desirable characteristics, including conserved regions for designing universal primers, ease of amplification, and adequate variability, to distinguish even closely related species (Kang et al. 2017).

Global distributions of S. himalayana have been reported from Myanmar, northeastern India, southeastern Tibet, Thailand and Vietnam (Elliott 1990; Hajra 1996). In India, William Griffith first reported S. himalayana in 1847 from the tropical wet evergreen forests of Mishmi Hills of Lohit District in Arunachal Pradesh. Since then, S. himalayana has also been reported from Assam, Manipur, and Meghalaya (Borah & Ghosh 2018; Ahmad et al. 2020). In Mizoram, S. himalayana was first reported by Lakshminarasimhan et al. (2013) from Tawi Wildlife Sanctuary in Aizawl, Mizoram. However, no molecular analysis has been undertaken thus far on S. himalayana plants found in Mizoram.

Recently, S. himalayana was spotted in an evergreen forest near Rullam village in Serchhip District of Mizoram, India. The plant is locally called ‘lei pangpar,’ meaning flower without a stalk. This study aimed, for the first time, to identify S. himalayana using DNA barcoding combined with morphological characterization. The genome of S. himalayana collected from Thailand has recently been published by Cai et al. (2021). However, to our knowledge, DNA barcoding of Indian materials of this rare species has not been conducted so far.

 

 

MATERIALS AND METHODS

 

Study area

Flowering buds of Sapria himalayana were collected from an evergreen forest near Rullam village in Serchhip District, Mizoram, India (Figure 1). The locality has an average elevation of 888 m and is situated at 23.44oN & 92.99 oE. The annual daily average temperature ranges 15–27 oC with moderate rainfall.

 

Collection of samples and Isolation of DNA

The samples were found attached to the roots of Tetrastigma species (T. obovatum Gagnep, T. pachyphyllum (Hemsl.) Chun, T. cruciatum Craib & Gagnep). The collected samples were brought to the Department of Botany, Mizoram University, for further investigation. Isolation of genomic DNA was done using the standard CTAB method (Doyle & Doyle 1990) with some modifications. Briefly, 200 mg of two flower buds was ground and analysed separately using a sterile mortar and pestle with 500 µl of extraction buffer (100 mM TrisHCl, 1.4M NaCl, 2 mmM EDTA, 2% CTAB, 1% PVP at pH 8), and incubated at 600C for 30 mins followed by centrifugation at 11,000 rpm for 15 mins. After RNase A treatment, the sample was incubated at 300C for 30 mins. Then, 500 µL Chloroform Isoamyl was added to the sample and centrifuged at 11,000 rpm for 1 min. A 0.7 volume of ice-cold isopropanol was added to precipitate the genomic DNA at -200C. The DNA was washed with 70% ethanol and dissolved in 30 µL TE buffer (10 mM TrisHCl, 1 mM EDTA).

 

Amplification of DNA, sequencing and analysis

The isolated DNA was amplified using ITS2 primers: F – GAAGGAGAAGTCGTAACAAGG, R – TCCTCCGCTTATTGATATGC and rbcL primers: F- CTGTATGGACCGATGGACTTAC, R-CGGTGGATGTGAAGAAGTAGAC  (Zahra et al. 2016) in a Veriti 96-Well Thermal Cycler (ABI, Thermo Fisher Scientific).

The amplified DNA products were cleaned and sent for commercial sequencing to AgriGenome (Cochin, India). The resultant sequence was analyzed using NCBI BLAST (ncbi.nlm.gov), and the similarity indices with the reference sequences from GenBank database were used for the species identification of the samples.

 

Phylogenetic analysis

A phylogenetic tree was constructed in MEGA X (Kumar et al. 2018) using the maximum likelihood (ML) method. The model suggested by Bayesian information Criterion (BIC) was T92 + G, with the lowest BIC score. The models with the lowest BIC scores were considered to describe the best substitution pattern (Posada & Crandall 2001). The phylogenetic tree was constructed using similar sequences identified from BLASTn analysis from Genbank. Species of closely related families from the same order (Malpighiales)- Euphorbia canariensis (Euphorbiaceae), Chaetocarpus echinocarpus (Peraceae) were also used, and a non-photosynthetic plant Conopholis americana (Orobanchaceae) was taken as an outgroup. Only when conspecific and congeneric species in the study formed a single clade with bootstrap P >50, the ML tree was considered successful.

 

 

RESULT AND DISCUSSION

 

Morphological characters of S. himalayana and the host plant

Sapria himalayana flowers and flower-buds were found growing on the roots of T. cruciatum. (Vitaceae). The host plant had leaves with tendrils arising from the bases of the petioles.

The collected flowers of S. himalayana (Image 1) were dark-red, mottled with yellowish-white dots, and had a bowl-shaped disk. Leaves were absent. The flowering occurs during winter, from November to February.

 

DNA - Isolation, Amplification, Sequencing and Analysis

The genomic DNA from S. himalayana was successfully isolated and amplified using ITS2 primer (Image 2). However, the rbcL primer failed to amplify the DNA.

The amplified DNA of S. himalayana was subjected to sequencing and the sequence was submitted to the GenBank database (MW788913). The amplicon (731 bp) also showed a high percentage similarity (97.44%) with the reference sequence (EU882286) from GenBank database.

 

Phylogenetic analysis

The ML-based phylogenetic tree of ITS2 showed high bootstrap values, and species of each genus were clustered on different branches and nodes as monophyletic taxon and clustered with the genus of other clades. The taxonomic units were statistically branched from their nodes with bootstrap P >70 for most of the sub-trees. Thus, the present study revealed that ITS2 had a high-resolution potential for the molecular taxonomy of S. himalayana. The collected sample was clustered together with other Sapria species. Here, S. himalayana formed a monophyletic group (bootstrap value = 100), and S. himalayana individuals showed coalescent stochasticity with high branch support value (bootstrap value = 100) (Figure 2) while other species were grouped into a different clade. Our study showed that the species from different families were discriminated clearly in a phylogenetic tree. Therefore, ITS2 locus-based ML phylogenetic tree can be used to identify unknown samples for molecular taxonomy and identification of rare and endangered species.

The identification and classification of plants based on their morphological characteristics are an integral part of taxonomy; however, identifying plants based on their morphology alone may sometimes be inaccurate (Feng et al. 2017). DNA barcoding is a valuable taxonomic tool for the identification of species. A study was conducted to identify S. himalayana from Thailand using ITS2 employing environmental DNA (eDNA) (Osathanunkul 2019). In our study, DNA barcoding of S. himalayana gDNA was successfully done using ITS2 primers, resulting in a 97.44% similarity with the reference sequences from the GenBank database; this confirms the identification of the studied plant sample. Another interesting observation was the failure to amplify the rbcL region of the species; this could be primarily due to heavy gene loss, including the plastid genome, as already reported for the genus Sapria (Cai et al. 2021) and hence loss of its photosynthetic activity. Thus, DNA barcoding can help derive an accurate phylogenetic classification. Therefore, the identification and classification of plants based on their morphology and DNA complement each other to attain accurate species identification.

 

 

CONCLUSION

 

Sapria himalayana, a rare and endangered holoparasitic plant, was collected from Mizoram. The results of DNA barcoding confirms the identification of this species. However, the distribution of this little known taxon is highly restricted in the region. This study suggests that focused explorations must be conducted in similar habitats to assess the population size. Suitable conservation measures are needed to protect this rare and interesting species from threat of extinction from the region.

 

 

Table 1. Flower description of Sapria himalayana.

Floral parts

Size

Flower

8 cm high; 14.5–15.5 cm in diameter

Outer Perigone Lobes

3.5–4.5 cm long; 3–4 cm wide

Inner Perigone Lobes

2.5–3 cm long; 2–2.5 cm wide

Disk

3.5–4 cm in diameter

Host Plant’s Root

1–2 cm in diameter

 

 

For figures & images - - click here for full PDF

 

 

REFERENCES

 

Ahmad, A., A. Kumar, S.G. Rawat & G.V. Gopi (2020). Recent record of a threatened holoparasitic plant Sapria himalayana Griff. in Mehao wildlife Sanctuary, Arunachal Pradesh, India. Journal of Threatened Taxa 12(10): 16399–16401. https://doi.org/10.11609/jot.5168.12.10.16399-16401

Borah, D. & D. Ghosh (2018). Sapria himalayana. Resonance 23(4): 479–489.

Cai, L., B.J. Arnold, Z. Xi, D.E. Khost, N. Patel, C.B. Hartmann, S. Manickam, S. Sasirat, L.A. Nikolov, S. Mathews, T.B. Sackton & C.C. Davis (2021). Deeply altered genome architecture in the endoparasitic flowering plant Sapria himalayana Griff. (Rafflesiaceae). Current Biology 31: 1002–1011.

Cosaic, E, P.M. Hollingsworth, S. Lavergne & P. Taberlet (2016). From barcodes to genomes: Extending the concept of DNA barcoding. Molecular Ecology 25: 1423–1428.

Doyle, J.J. & J.J. Doyle (1990). Isolation of plant DNA drom fresh tissue. Focus 12: 13-15.

Elliott, S. (1990). The distribution, status and ecology of Sapria himalayana Griff. (Rafflesiaceae) in Thailand. The Bulletin of British Ecological Society 11: 246–248.

Feng, S., K. Jiao, Y. Zhu, H. Wang, M. Jiang & H. Wang (2017). Molecular identification of Physalis species (Solanaceae) using a candidate DNA barcode: the chloroplast psbA-trn H intergenic region. Genome 61: 15–2.

Hajra, P.K. (1996). A Contribution to the Flora of Namdapha, Arunachal Pradesh. Botanical Survey of India, Kolkata, India, 476 pp.

Kang, Y., Z. Deng, R. Zang & W. Long (2017). DNA barcoding analysis analysis and phylogenetic relationship of tree species in tropical cloud forests. Scientific Report 7(1): 1–9. https://doi.org/10.1038/ s41598-017-13057-0.

Kumar, S., G. Stecher, M. Li, C. Knyaz & K. Tamura (2018). MEGA X: molecular evolutionary genetics analysis across computing platforms. Molecular Biology and Evolution 35(6): 1547–1549.

Lakshminarasimhan, P., W. Arisdason, S. Bandyopadhyay, T.K. Paul, E.N.V.I.S. Team, S. Gantait, T. Chakrabortty, S. Nandi, D.E. Operator, M.K. Das & N.P. Balakrishnan (2013). “Sapria himalayana (Rafflesiaceae) from Mizoram”. Envis Newsletter 18(1): 2.

Osathanunkul, M. (2019). eDNA-based monitoring of parasitic plant (Sapria himalayana). Scientific Reports 9(1): 1–5. https://doi.org/10/1038/s41598-019-45647-5

Posada, D., &  K.A. Crandall (2001). Selecting the best-fit model of nucleotide substitution. Systematic Biology 50(4): 580–601.

Rubiales, J.M., L. Hernández, F. Romero & C. Sanz (2011). The use of forest resources in central Iberia during the Late Iron Age. Insights from the wood charcoal analysis of Pintia, a Vaccaean oppidum. Journal of Archaeological Science 38(1): 1–10. https://doi.org/10.1002/9780470015902.a0021271

Saddhe, A.A. & K. Kumar (2018). DNA barcoding of plants: selection of core markers for taxonomic groups. Plant Science Today 5(1): 9–13.

Trần, H.Đ., H.T. Lưu, Q.Đ. Nguyễn, H.C. Nguyễn, P. Athen & K.M. Wong (2018). Identification, sexual dimorphism and aspects of the natural history of Sapria himalayana (Rafflesiaceae) on Vietnam’s Lang Biang Plateau. Botanical studies 59(1): 1–10.

Yang, F., F. Ding, H. Chen, M. He, S. Zhu, X. Ma, J. Li & H. Li (2018). DNA barcoding for the identification and authentication of animal species in traditional medicine. Evidence-Based Complementary and Alternative Medicine. https://doi.org/10.1155/2018/5160254

Zahra, N.B., Z.K. Shinwari & M. Qaiser (2016). DNA barcoding: a tool for standardization of herbal medicinal products (HMPS) of Lamiaceae from Pakistan. Pakistan Journal of Botany 48: 2167–2174.