Journal of Threatened Taxa | www.threatenedtaxa.org | 26 June 2021 | 13(7): 18878–18887

ISSN 0974-7907 (Online) | ISSN 0974-7893 (Print)

https://doi.org/10.11609/jott.6978.13.7.18878-18887

#6978 | Received 11 December 2020 | Final received 12 February 2021 | Finally accepted 09 June 2021

Occurrence of gilled fungi in Puducherry, India

Vadivelu Kumaresan ¹, Chakravarthy Sariha ², Thokur Sreepathy Murali ³ & Gunasekaran Senthilarasu ⁴

^1,2 Department of Botany, Kanchi Mamunivar Government Institute for Postgraduate Studies and Research, Puducherry 605008, India.

³ Department of Biotechnology, Manipal School of Life Sciences, Manipal Academy of Higher Education, Manipal, Karnataka 576104, India.

⁴ Weikfield Foods Private Ltd., Jamadar Hills Road, Bakori, Pune, Maharashtra 412207, India.

¹ vkumaresan36@gmail.com (corresponding author), ² sariha.cm@gmail.com, ³ murali.ts@manipal.edu, ⁴ senthilarasug28@gmail.com

Editor: Anonymity requested. Date of publication: 26 June 2021 (online & print)

Citation: Kumaresan, V., C. Sariha, T.S. Murali & G. Senthilarasu (2021). Occurrence of gilled fungi in Puducherry, India. Journal of Threatened Taxa 13(7): 18878–18887. https://doi.org/10.11609/jott.6978.13.7.18878-18887

Copyright: © Kumaresan et al. 2021. Creative Commons Attribution 4.0 International License. JoTT allows unrestricted use, reproduction, and distribution of this article in any medium by providing adequate credit to the author(s) and the source of publication.

Funding: VK thanks UGC SERO (MRP-2192/06; MRP-6365/16) for financial assistance.

Competing interests: The authors declare no competing interests.

Author details: Dr. Vadivelu Kumaresan is an Assistant Professor of Botany at Kanchi Mamunivar Govt. Institute for Postgraduate Studies and Research (Autonomous), Puducherry. He has been working on the diversity of macrofungi in Puducherry and other parts of southern India and fungal endophytes of various groups of plants. Ms. Sariha Charkravarthy is a Research Scholar pursuing Ph.D. in Botany with interest in macrofungal diversity and heavy metal detoxification by plants. Dr. Thokur Sreepathy Murali is working as an Associate Professor in Manipal School of Life Sciences, Manipal Academy of Higher Education. His research interests include understanding the diversity of micro and macrofungi, infectious microbes and fungal secondary metabolites. Dr. Gunasekaran Senthilarasu is an expert in gilled fungal identification who has worked extensively in southern as well as western parts of India including forests of Western and Eastern Ghats. Presently he is working on cultivation of white button mushrooms.

Author contributions: VK—carried out field trips to various places in Puducherry to record gilled fungi. He did the major part of morphological and microscopic characterization of gilled fungi and wrote the manuscript. SC—Ph.D. scholar carrying out research work under the supervision of Dr. Vadivelu Kumaresan helped in sampling gilled fungi and carrying out part of microscopic analysis. TSM—sequenced the ITS region of three gilled fungi and carried out phylogenetic analysis.

SG—assisted in identifying and describing some of the species of agarics mentioned in the present study.

Acknowledgements: VK thanks Dr. M. Sangararadje, Director, Dr. B.K. Nayak, Head of the Department of Botany, KMGIPSR, Puducherry for facilities and encouragement, and UGC SERO (MRP-2192/06; MRP-6365/16) for financial assistance.

Abstract: Thirty-three species of gilled fungi belonging to 23 genera and 14 families were recorded from Puducherry, southern India. Agaricaceae were represented by eight species, followed by Psathyrellaceae (5), Lyophyllaceae & Marasmiaceae (3 each), Hymenogastraceae, Pleurotaceae, Pluteaceae, & Polyporaceae (2 each), and Biannulariaceae, Bolbitiaceae, Omphalotaceae, Schizophyllaceae, Strophariaceae, & Tricholomataceae (1 each). Fourteen species of agarics are new reports from Puducherry. Chlorophyllum rhacodes, Lactocollybia epia, Leucoagaricus meleagris, and Schizophyllum commune were widely distributed. Phylogenetic relationships of the abundant species C. rhacodes, L. epia, and L. meleagris were inferred by maximum likelihood method.

Keywords: Agarics, Agaricaceae, mushrooms, phylogeny, southern India, taxonomy.

INTRODUCTION

Gilled fungi belonging to Agaricales Underw. constitute ~10% of fungal species described so far (Kirk et al. 2008). It has been assumed that India hosts one-third of the global fungal taxa (Manoharachary et al. 2005) and hence there is an urgent need to document fungi in the unexplored parts of this country covering all possible habitats and seasonal variations. This will help in maintaining the germplasm of these important fungi, as well as to screen these macrofungi for their unique and versatile metabolic potential.

Gilled fungi in Puducherry have not been extensively studied. Studies on the diversity of macrofungi in adjacent areas are by Mani & Kumaresan (2009a,b). Thirty species of white-spored agarics have been reported from Puducherry (Kumaresan et al. 2011), although their identity was not confirmed by phylogenetic inferences. With the rapid deterioration of natural habitats due to human activity, it has become imperative to record these fungi before they become extinct. The study becomes even more interesting considering the fact that these basidiomata are ephemeral, especially the gilled fungi. Moreover, scientists have taken recourse to molecular techniques for identification of these poorly-studied organisms. Many Indian species are called after their North American or European lookalikes (Cannon & Kirk 2007). Sequencing the internal transcribed spacer region for as many fungi as possible from different regions will help immensely in creating or adding to the existing sequence database, to resolve the identities of species complexes and uncover new taxa.

MATERIALS AND METHODS

Basidiomata were sampled during the rainy season of 2007–2009 and 2016–2019 from different places in Puducherry, located 160 km south of Chennai on the southeastern coast of India. The area has a tropical climate and receives a mean annual rainfall of around 126 cm during the north-east monsoon in the months of October–December. During collection, photographs of fresh specimens were taken and morphological characters of fresh basidiomata such as colour (Kornerup & Wanscher 1978), size, and gill attachment were recorded in the field (Senthilarasu & Kumaresan 2018). Dried basidiomata were sealed in zip lock polythene covers after labeling for further microscopic studies. Samples are maintained in the mushroom herbarium collection in the Department of Botany, Kanchi Mamunivar Government Institute for Postgraduate Studies and Research, Puducherry, India.

Microscopic examination

Thin hand-made sections of the pileus and gills were taken and revived in 5–10 % KOH and stained with phloxine (1 %). Microscopic features were recorded following Largent (1977). Approximately, 30 basidiospores sections were measured, excluding the apiculus. The spore quotient (Q) was obtained by dividing the mean length by the mean width in profile view.

DNA extraction and PCR amplification

Few nuclear ribosomal internal transcribed spacer sequences are available for a majority of the species observed here, thus we isolated whole genomic DNA and amplified the ITS sequence to compare it with available sequences in the NCBI database.

The pure fungal culture of Leucoagaricus meleagris was inoculated onto potato dextrose agar and grown for 10 days at 26 °C, and the mycelia were processed for genomic DNA isolation (Paranetharan et al. 2018). Dried basidiomata of Chlorophyllum rhacodes and Lactocollybia epia were processed for genomic DNA isolation following the method of Gardes & Bruns (1993). Using the fungal specific primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS4B (CAGGAGACTTGTACACGGTCCAG) (Gardes & Bruns 1993), a PCR reaction was performed to amplify the internal transcribed spacer (ITS) region. The PCR mix consisted of PCR buffer, forward and reverse primers (10 μM each), dNTPs (4 mM), Taq Polymerase (1 U), DMSO (1 %), MgCl₂ (25 mM) and genomic DNA (10–25 ng).

The PCR amplification was performed as follows: 95 ºC for 10 min, 30 cycles of 95 ºC for 30 s, 55 ºC for 30 s and 72 ºC for 60 s; and 72 ºC for 10 min. The PCR products were purified and sequenced using ABI 3130 genetic analyzer using primers ITS1F and ITS4B.

Phylogenetic analyses

Sequences were compared using NCBI Blast. Sequences with significant matches were selected and aligned using ClustalW (Thompson et al. 1994), checked visually and edited as required, and evolutionary trees were inferred using the maximum likelihood approach (Kimura 1980) using MEGA v6.06 (Tamura et al. 2013). Bootstrap analysis (1,000 replicates) was performed to calculate the branch support (Felsenstein 1985).

RESULTS

A total of 33 species of gilled fungi from 23 genera in 14 families were recorded from Puducherry. Of these, eight species from four genera belonged to Agaricaceae, constituting the dominant family among the 14 agaric families. Psathyrellaceae was represented by five species from three genera, Lyophyllaceae by three species from one genus and Marasmiaceae by three species from three genera, and Hymenogastraceae, Pleurotaceae, Pluteaceae, and Polyporaceae by two species each (Table 1, Images 1–3).

Taxonomy

Agaricus endoxanthus Berk. & Broome, J. Linn. Soc., Bot. 11(no. 56): 548 (1871).

Pileus 40–90 mm diam., convex to plano-convex with broad umbo, dark brown (6E8) to henna brown (7E8) at disc, fading towards margin, pileus easily peeling off, surface dry, appressed fibrillose, margin decurved, entire. Lamellae free, crowded, reddish-brown (8D6), edge smooth. Stipe 45–100 × 5–13 mm, central, terete, broadened towards base, white, greyish-brown (5D3) near base, fleshy fibrous, hollow, surface smooth. Annulus superior, membranous, large. Basidiospores 4.5–6.0 × 3–4.5 µm, Q= 1.46, ovoid to ellipsoid, brown, thick-walled.

On ground, in groups. (PY096).

Agaricus trisulphuratus Berk., Ann. Mag. nat. Hist., Ser. 5 15: 386 (1885).

Pileus 20–30 mm diam., globoso-campanulate to convex, surface with cadmium orange (5A8) to salmon orange (6C4) with thick pulverulent veil, later fading away, margin appendiculate. Lamellae free, dark henna brown (7E8), crowded. Stipe 25–45 × 2–4 mm, terete, equal, surface below the annulus concolorous with the pileus and covered by pulverulent veil. Annulus superior, fugacious. Basidiospores 4.5–6.5 × 3–4 µm, Q= 1.53, ovoid to ellipsoid, brown, thick-walled.

On ground, solitary. (PY109).

Agrocybe manihotis Pegler, Kew Bull. 21(3): 508 (1968).

Pileus 30 mm diam., convex, greyish–orange (5B3), smooth, margin decurved, entire. Lamellae adnexed, brownish grey (5C2), crowded. Stipe 45 × 5 mm, central, concolorous with the pileus, cartilagenous, smooth. Spore-print brown. Basidiospores 10.5–12 × 6.5–7.5 μm, Q= 1.61, ellipsoid, thick-walled with truncated germ pore, brown. Pleurocystidia pyriform, 32–45 × 16–20 µm, Cheilocystidia broadly clavate to cylindric, 24–30 × 8–10 µm.

On ground along the grass, solitary. (PY1746).

Coprinopsis lagopus (Fr.) Redhead, Vilgalys & Moncalvo, in Redhead, Vilgalys, Moncalvo, Johnson & Hopple, Taxon 50(1): 229 (2001).

Pileus 30–45 mm diam., plano-convex to plane, initially yellowish-brown (5D8) at the disc, becoming brown (6E8), brownish-orange (5C5, 5C4) towards margin, surface dry, margin plane, crenate, plicate-striate. Lamellae adnate, subdistant, width 3 mm, teak brown (6F5), edge smooth. Stipe 30–55 × 2–4 mm, central, terete, with slightly bulbous base (10 mm diam.), white, surface with striations and superficial pruinose scales, cartilagenous, hollow, small collar like ring at the base. Rhizomorphs present. Spore-print black. Basidiospores 9.5–12 × 5.5–7 µm, Q= 1.78, ellipsoid to elongate-ellipsoid, truncated by apical germ-pore, black, smooth.

Scattered, on ground. (PY098).

Gymnopilus subtropicus Hesler, Mycol. Mem. 3: 41 (1969).

Pileus 20–60 mm diam., convex to plane, apricot yellow (5B6) fading towards the margin to butter yellow (4A5), squamulose at the disc reddish-brown (9E8), greyish ruby (12D7) in young, surface dry, margin decurved, entire. Lamellae adnate with decurrent tooth, close, greyish-orange (5B4), gill edge smooth, lamellulae of 5 lengths, width 5 mm. Stipe 30–50 × 3–8 mm, terete, hollow, butter yellow (4A5), base hygrophanous to reddish-brown (9F8), fleshy fibrous, striate due to appressed scales. Spore-print brownish-orange. Basidiospores 5.5–8 × 4–5 µm, Q = 1.51, ellipsoid, brown, verruculose.

On palm trunk, in groups. (PY119).

Leucoagaricus meleagris (Gray) Singer, Lilloa 22: 422 (1951) [1949].

Pileus 25–35 mm diam., convex to expanded convex, broadly parabolic when young, dark brown (8F8) at the disc, white towards the margin, surface pruinose, margin decurved, entire. Lamellae free, white, crowded. Stipe 60–110 × 5–8 mm, central, terete, expanding towards the base, fleshy fibrous, smooth, solid. Annulus superior. Spore-print white. Basidiospores 6–8 × 5–6 µm, Q= 1.53, broadly ellipsoid to ellipsoid, slightly truncated with germ-pore, hyaline, dextrinoid with a thickened wall, guttulate. Pleurocystidia absent. Chielocystidia 25–45 × 10–15 µm ellipsoid to short cylindric with pronounced mucronate apex.

On decaying wood, in groups and scattered. (PY19111).

Macrocybe lobayensis (R. Heim) Pegler & Lodge, in Pegler, Lodge & Nakasone, Mycologia 90(3): 498 (1998).

Pileus 50–120 mm diam., convex, white, plane, dry, margin decurved, entire. Lamellae adnate, whitish to cream, crowded. Stipe 40–100 × 15–35 mm, central, white, fleshy fibrous, smooth, solid. Spore-print white. Basidiospores 4–6 × 3–4.5 µm, Q = 1.32, broadly ellipsoid to ellipsoid, thin-walled, hyaline.

On ground, on soil root interface, solitary. (PY19126).

Marasmiellus confluens (Pers.) J.S. Oliveira, in Oliveira, Vargas-Isla, Cabral, Rodrigues & Ishikawa, Mycol. Progr. 18(5): 734 (2019).

Pileus 15–25 mm diam., convex to plane, dry, reddish brown (9E8) at the disc, brown (6D8) towards the margin, margin decurved, striate. Lamellae adnexed, white to yellowish-white (1A2), crowded. Stipe 25–60 × 2–3 mm, central to slightly eccentric, concolorous with the pileus, terete to compressed. Spore-print white. Basidiospores 5–6.5 × 2–3 μm, Q= 2.34, elongate to cylindric, nearly fusoid, hyaline, inamyloid. Pleurocystidia absent. Chielocystidia 32–40 × 3.5–5.5 μm, cylindric to subfusoid, flexuous, often somewhat lobed and diverticulate.

On leaf litter in groups, scattered. (PY1931).

Panaeolus cyanescens Sacc., Syll. fung. (Abellini) 5: 1123 (1887).

Pileus 20–35 mm diam., convex to conico-convex, disc brownish-grey (5C3), yellowish-white (4A2) to yellowish-grey (4B2), towards margin, surface dry, smooth, becoming bluish-green on bruising, margin decurved, entire. Lamellae adnate to adnexed, close, yellowish-brown (5D8) to raw umber (5F8). Stipe 50–60 × 2–3 mm, terete, equal, yellowish white (4A2) to yellowish-grey (4B2), cartilaginous, hollow, surface superficially pruinose, bluish-green on bruising. Basidiospores 11.5–14 × 7–8.5 µm, Q = 1.65, lenticular, limoniform in face-view, elongate-ellipsoid in side view, blackish-brown, smooth apically truncated by a germ-pore.

On soil and decaying litter, in groups. (PY092).

Parasola plicatilis (Curtis) Redhead, Vilgalys & Hopple, in Redhead, Vilgalys, Moncalvo, Johnson & Hopple, Taxon 50(1): 235 (2001).

Pileus 20–25 mm diam., membranous, convex to plane, greyish-yellow (4B5) at the disc, grooves orange white (6A2), olive brown (4D8) elsewhere, surface dry, plicate striate, margin plane, crenate. Lamellae free, brownish grey (4D2), subdistant. Stipe 85–100 × 1–2 mm, central, terete, white, cartilagenous, smooth, inserted. Basidiospores 11.5–14.5 × 8.5–10.5 µm, Q= 1.47, lenticular, ellipsoid in side view, with abaxially inclined germ-pore, black, smooth.

Solitary, on ground. (PY065).

Psathyrella candolleana (Fr.) Maire, in Maire & Werner, Mém. Soc. Sci. Nat. Maroc. 45: 112 (1937).

Pileus 20–35 mm diam., convex to broadly companulate, brown (6E8) to brownish-orange (5C4), margin appendiculate. Lamellae adnexed, dark brown (9F7), crowded. Stipe 40–70 × 3–4 mm, central, white, terete, smooth, hollow. Spore-print dark brown. Basidiospores 6–7.5 × 3.5–4.5 µm, Q= 1.69, ellipsoid to elongate ellipsoid, with a truncated end, smooth, dark brown. Pleurocystidia absent. Chielocystidia 20–30 × 7–12 μm, cylindric with rounded apex.

On ground, in groups and scattered. (PY101).

Psathyrella glaucescens Dennis, Kew Bull. 15(1): 128 (1961).

Pileus 10–40 mm diam., conico-convex to convex, pale orange (5A3) to brownish-orange (6C4), margin white to light grey (1C3), surface dry, smooth, margin appendiculate. Lamellae adnate, brownish-orange (7C4) to greyish red (8C4). Stipe 30–70 × 2–4 mm, white, silky fibrillose, cartilaginous, hollow. Basidiospores 6.5–8 × 4–5 µm, Q = 1.63, ellipsoid, purplish-brown, apically truncated by a germ-pore.

On ground, in groups. (PY003).

Psathyrella obtusata (Pers.) A.H. Sm., Contr. Univ. Mich. Herb. 5: 55 (1941).

Pileus 15–40 mm diam., convex to broadly campanulate, cinnamon brown (6D6) at the disc, brownish-orange (6C4) elsewhere, dry, smooth, margin decurved, plane and uplifted, striate at extreme margin, crisped. Lamellae adnate, close, greyish-orange (6B3). Stipe 25–35 × 1–2 mm, terete, equal, white, cartilagenous, smooth, hollow, inserted. Basidiospores 6.5–8 × 5–6 µm, Q= 1.31, broadly ellipsoid to ellipsoid, truncated by an apical germ pore.

On ground, in groups and scattered. (PY108).

Termitomyces clypeatus R. Heim, Bull. Jard. bot. État Brux. 21: 207 (1951).

Pileus 40–70 mm diam., convex to expanded convex with a spiniform perforatium, broadly parabolic when young, surface dark brown (7F8) at the disc, fading towards the margin, smooth, margin decurved, entire. Lamellae adnexed to free, pinkish white (8A2), crowded. Stipe 50–60 × 8–10 mm, central, terete, expanding towards the base, fleshy fibrous, smooth, solid. Pseudorrhiza present. Spore-print pink. Basidiospores 5–7 × 3–4 µm, Q= 1.62, ellipsoid to elongate ellipsoid, hyaline, guttulate. Pleurocystidia pyriform. Chielocystidia subglobose.

On soil, solitary to scattered. (PY1878).

Phylogenetic analysis

The sequences obtained from Chlorophyllum rhacodes, Leucoagaricus meleagris and Lactocollybia epia have been deposted in GenBank with the accession numbers MT229200, MT229202, KU320581, respectively. We constructed maximum likelihood trees to compare our sequences to understand their phylogenetic relationship with related sequences from the database (Figures 1–3). The phylogenetic tree generated using ITS dataset for C. rhacodes and related species included 28 nucleotide sequences. The tree with the highest likelihood (-2549.8398) is depicted (Figure 1). For constructing the tree, all positions with less than 95 % site coverage were eliminated and the final dataset included 537 positions. The ITS sequence of C. rhacodes from this study (MT229200) was placed in the same subclade containing sequence belonging to ITS sequence of C. rhacodes isolated from Gorakhpur, India (MH820354) with 100 % support. The maximum likelihood tree generated for ITS sequence of L. meleagris and its other related species included 17 nucleotide sequences. The tree with the highest likelihood (-1609.0537) is depicted (Figure 2). The final dataset included 604 positions after removing all positions with less than 95 % site coverage. Our isolate (MT229202) clustered in the same subclade with other L. meleagris isolate (GQ249888) from Rajasthan, India with 100 % bootstrap support. For L. epia and its related isolates, the maximum likelihood tree generated included 20 nucleotide sequences and the tree with the highest likelihood (-3410.7721) is shown (Figure 3). The final dataset included 412 positions after removing all positions with less than 95 % site coverage. Our isolate (KU320581) clustered together with L. epia (MN523272), an isolate obtained from China, and showed 100 % bootstrap support.

DISCUSSION

Puducherry does not have any major forest, but there are patches of tropical dry evergreen forest and small areas of sacred groves and mangroves (Ponnuchamy et al. 2013). Therefore, not much litter deposition occurs to create conditions favourable for litter fungi. Studies on the occurrence of agarics in Puducherry resulted in recording more gilled fungi from soil as substrate including A. endoxanthus, A. trisulphuratus, C. molybdites, C. rhacodes, L. serenus, P. cyanescens, three species of Termitomyces, V. hypopithys, C. lagopus, P. plicatilis, three species of Psathyrella, A. manihotis, L. hyalodes, and M. lobayensis. Most of the dark-spored species recorded in the present study were reported by Natarajan & Raman (1983) in tropical dry evergreen forest areas. This shows that forest type plays an important role in determining agaric species composition (Küffer& Senn-Irlet 2005). The 10 dark-spored species along with four white-spored ones recorded in the present study are reported for the first time from Puducherry (Table 1). Among the three species of Psathyrella sampled in the present study, P. candolleana is known to be widely distributed (Manjula 1983; Natarajan et al. 2005; Farook et al. 2013; Amandeep et al. 2015a). Interestingly, a total of 53 species of Psathyrella have been recorded from India (Amandeep et al. 2015a); however, P. glaucescens and P. obtusata recorded in the present study have so far not been reported from southern India. Similarly, the genus Termitomyces, one of the mushrooms of tribal importance (Varghese et al. 2010), was represented by three species, of which T. microcarpus has been reported widely (Karun & Sridhar 2013).

Vellinga (2002) based on similarities in morphology and molecular studies transferred a few species previously placed in Macrolepiota Singer or Lepiota (Pers.) Gray, into Chlorophyllum. Most of the Chlorophyllum species occur in arid habitats in subtropical to tropical regions (Ge et al. 2018). In India, C. rhacodes is known to be widely distributed and recorded as Macrolepiota rhacodes earlier (Manjula 1983; Amandeep et al. 2015b). We found C. rhacodes to occur in a number of places in Puducherry and the identity of the species was confirmed through ITS sequence analysis by constructing maximum likelihood based phylogenetic tree (Figure 1). Interestingly, phylogenetic analysis of ITS sequences from two species which occurred widely in Puducherry showed that L. meleagris (Syn: Leucocoprinus meleagris) (Figure 2) clustered with L. meleagris reported from Rajasthan, India while L. epia (Figure 3) formed a tight cluster with L. epia reported earlier from China.

Table 1. Gilled fungal species recorded from Puducherry, India.

Family	Genus	Species
Agaricaceae	Agaricus	Agaricus endoxanthus Berk. & Broome
		Agaricus trisulphuratus Berk.
	Chlorophyllum	Chlorophyllum molybdites (G. Mey.) Massee*
		Chlorophyllum rhacodes (Vittad.) Vellinga*
	Leucoagaricus	Leucoagaricus meleagris (Gray) Singer
		Leucoagaricus serenus (Fr.) Bon & Boiffard*
	Leucocoprinus	Leucocoprinus birnbaumii (Corda) Singer*
		Leucocoprinus cepistipes  (Sowerby) Pat.*
Biannulariaceae	Macrocybe	Macrocybe lobayensis (R. Heim) Pegler & Lodge
Bolbitiaceae	Panaeolus	Panaeolus cyanescens Sacc.^#
Hymenogastraceae	Gymnopilus	Gymnopilus subtropicus Hesler
	Naucoria	Naucoria conicopapillata (Henn.) Sacc.*
Lyophyllaceae	Termitomyces	Termitomyces clypeatus R. Heim
		Termitomyces microcarpus (Berk. & Broome) R. Heim*
		Termitomyces striatus (Beeli) R. Heim*
Marasmiaceae	Crinipellis	Crinipellis megalospora Singer*
	Lactocollybia	Lactocollybia epia (Berk. & Broome) Pegler*^#
	Tetrapyrgos	Tetrapyrgos nigripes (Fr.) E. Horak*
Omphalotaceae	Marasmiellus	Marasmiellus confluens (Pers.) J.S. Oliveira
Pleurotaceae	Hohenbuehelia	Hohenbuehelia atrocoerulea (Fr.) Singer*
	Pleurotus	Pleurotus ostreatus (Jacq.) P. Kumm.*
Pluteaceae	Volvariella	Volvariella hypopithys (Fr.) Shaffer*
		Volvariella volvacea (Bull.) Singer*
Polyporaceae	Lentinus	Lentinus cladopus Lév.*
		Lentinus squarrosulus Mont.*
Psathyrellaceae	Coprinopsis	Coprinopsis lagopus (Fr.) Redhead, Vilgalys & Moncalvo
	Parasola	Parasola plicatilis (Curtis) Redhead, Vilgalys & Hopple
	Psathyrella	Psathyrella candolleana (Fr.) Maire
		Psathyrella glaucescens Dennis
		Psathyrella obtusata (Pers.) A.H. Sm.
Schizophyllaceae	Schizophyllum	Schizophyllum commune Fr.*
Strophariaceae	Agrocybe	Agrocybe manihotis Pegler
Tricholomataceae	Lepista	Lepista hyalodes (Berk. & Broome) Pegler*^#

*The species have already been recorded with brief descriptions in Kumaresan et al. (2011). The remaining species are recorded for first time from Puducherry. ^#Incertae sedis.

For figures & images – click here

REFERENCES

Amandeep, K., N.S. Atri & K. Munruchi (2015a). Psathyrella (Psathyrellaceae, Agaricales) species collected on dung from Punjab, India. Current Research in Environmental & Applied Mycology 5(2): 128–137. https://doi.org/10.5943/cream/5/2/6

Amandeep, K., N.S. Atri & K. Munruchi (2015b). A Checklist of Coprophilous Agarics of India. Current Research in Environmental & Applied Mycology 5(4): 322–348. https://doi.org/10.5943/cream/5/4/3

Cannon, P.F. & P.M. Kirk (2007). Fungal Families of the World. CABI, UK, 456pp.

Farook, V.A., S.S. Khan & P. Manimohan (2013). A checklist of agarics (gilled mushrooms) of Kerala State, India. Mycosphere 4: 97–131.

Felsenstein, J. (1985). Confidence limits on phylogenies: An approach using the bootstrap. Evolution 39: 783–791.

Gardes, M. & T.D. Bruns (1993). ITS primers with enhanced specificity for basidiomycetes – application to the identification of mycorrhizae and rusts. Molecular Ecology 2: 113–118.

Ge, Z.-W., A. Jacobs, E.C. Vellinga, P. Sysouphanthong, R. van der Walt, C. Lavorato, Y.-F. An & Z.L. Yang (2018). A multi-gene phylogeny of Chlorophyllum (Agaricaceae, Basidiomycota): new species, new combination and infrageneric classification. MycoKeys 32: 65–90. https://doi.org/10.3897/mycokeys.32.23831

Karun, N.C. & K.R. Sridhar (2013). Occurrence and distribution of Termitomyces (Basidiomycota, Agaricales) in the Western Ghats and on the west coast of India. Czech Mycology 65: 233–254.

Kimura, M. (1980). A simple method for estimating evolutionary rate of base substitutions through comparative studies of nucleotide sequences. Journal of Molecular Evolution 16: 111–120.

Kirk, P.M., P.F. Cannon, D.W. Minter & J.A. Stalpers (2008). Ainsworth & Bisby’s Dictionary of the Fungi, 10th Edition. CABI, Wallingford.

Kornerup, A. & J.H. Wanscher (1978). Methuen Handbook of Colour. 3rd edition. Eyre Methuen, London.

Küffer N. & B. Senn-Irlet (2005). Influence of forest management on the species richness and composition of wood-inhabiting basidiomycetes in Swiss forests. Biodiversity and Conservation 14: 2419–2435.

Kumaresan, V., R. Veeramohan & T. Ganesan (2011). Diversity of white-spored agarics in Puducherry. Journal of Mycology and Plant Pathology 41: 518–523.

Largent, D.L. (1977). How to identify Mushrooms to genus I: Macroscopical Features. Mad Rivers Press, Eureka, USA, 85pp.

Mani, S. & V. Kumaresan (2009a). Occurrence of macrofungi on the Coromandel coast of Tamil Nadu, southern India. Journal of Threatened Taxa 1(1): 54–57. https://doi.org/10.11609/JoTT.o1773.54-7

Mani, S. & V. Kumaresan (2009b). Diversity and distribution of macrofungi in the man-made Pitchandikulam Forest of Tamil Nadu, southern India. Journal of Threatened Taxa 1(6): 340–343. https://doi.org/10.11609/JoTT.o2129.340-3

Manjula, B. (1983). A revised list of the agaricoid and boletoid basidiomycetes from India and Nepal. Proceedings of the Indian Academy of Sciences (Plant Sciences) 92: 81–213.

Manoharachary, C., K. Sridhar, R. Singh, A. Adholeya, T.S. Suryanarayanan, S. Rawat & B.N. Johri (2005). Fungal biodiversity: distribution, conservation and prospecting of fungi from India. Current Science 89: 58–71.

Natarajan, K., V. Kumaresan & K. Narayanan (2005). A checklist of Indian agarics and boletes (1984–2002). Kavaka 33: 61–128.

Natarajan, K. & N. Raman (1983). South Indian Agaricales: A preliminary study on some dark spored species. Bibliotheca Mycologica Vol 89. J. Cramer, Germany, 203pp.

Paranetharan, M.S., N. Thirunavukkarasu, T. Rajamani, T.S. Murali & T.S. Suryanarayanan (2018). Salt-tolerant chitin and chitosan modifying enzymes from Talaromyces stipitatus, a mangrove endophyte. Mycosphere 9: 215–226.

Ponnuchamy, R., A. Pragasam, S. Aravajy, P. Patel, L. Das & K. Anupama (2013). A floristic study on herbs and climbing plants at Puducherry, South India: an approach to biodiversity conservation and regeneration through eco-restoration. Check List 9: 555–600.

Senthilarasu, G. & V. Kumaresan (2018). Mushroom Characterization: Part I – Illustrated Morphological Characteristics. Current Research in Environmental & Applied Mycology 8: 501–555.

Tamura, K., G. Stecher, D. Peterson, A. Filipski & S. Kumar (2013). MEGA6: Molecular Evolutionary Genetics Analysis version 6.0. Molecular Biology and Evolution 30: 2725–2729.

Thompson, J.D., D.G. Higgins & T.J. Gibson (1994). CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Research 22: 4673–4680.

Varghese, S.P.,  C.K. Pradeep & K.B. Vrinda (2010). Mushrooms of tribal importance in Wayanad area of Kerala.  Journal of Mycopathological Research 48(2): 311–320.

Vellinga, E.C. (2002). New combinations in Chlorophyllum. Mycotaxon 83: 415–417.