Journal of Threatened Taxa |
www.threatenedtaxa.org | 26 June 2021 | 13(7): 18878–18887
ISSN 0974-7907 (Online) | ISSN 0974-7893
(Print)
https://doi.org/10.11609/jott.6978.13.7.18878-18887
#6978 | Received 11 December 2020 | Final
received 12 February 2021 | Finally accepted 09 June 2021
Occurrence of gilled fungi in
Puducherry, India
Vadivelu Kumaresan
1, Chakravarthy Sariha 2, Thokur Sreepathy Murali 3
& Gunasekaran Senthilarasu 4
1,2 Department of Botany, Kanchi Mamunivar Government
Institute for Postgraduate Studies and Research, Puducherry 605008, India.
3 Department of Biotechnology, Manipal School of Life
Sciences, Manipal Academy of Higher
Education, Manipal, Karnataka 576104, India.
4 Weikfield Foods Private Ltd., Jamadar
Hills Road, Bakori, Pune, Maharashtra 412207, India.
1 vkumaresan36@gmail.com
(corresponding author), 2 sariha.cm@gmail.com, 3 murali.ts@manipal.edu, 4 senthilarasug28@gmail.com
Editor: Anonymity
requested. Date of publication:
26 June 2021 (online & print)
Citation: Kumaresan,
V., C. Sariha, T.S. Murali & G. Senthilarasu (2021). Occurrence of
gilled fungi in Puducherry, India. Journal of Threatened Taxa 13(7): 18878–18887. https://doi.org/10.11609/jott.6978.13.7.18878-18887
Copyright: © Kumaresan
et al. 2021. Creative Commons Attribution
4.0 International License. JoTT allows unrestricted use, reproduction, and
distribution of this article in any medium by providing adequate credit to the
author(s) and the source of publication.
Funding: VK thanks
UGC SERO (MRP-2192/06; MRP-6365/16) for financial
assistance.
Competing interests: The authors
declare no competing interests.
Author details: Dr. Vadivelu Kumaresan is an Assistant Professor of
Botany at Kanchi Mamunivar
Govt. Institute for Postgraduate Studies and Research (Autonomous), Puducherry.
He has been working on the diversity of macrofungi in
Puducherry and other parts of southern India and fungal endophytes of various
groups of plants. Ms. Sariha
Charkravarthy is a Research Scholar pursuing
Ph.D. in Botany with interest in macrofungal diversity and heavy metal
detoxification by plants. Dr. Thokur Sreepathy Murali is working as an Associate
Professor in Manipal School of Life Sciences, Manipal Academy of Higher
Education. His research interests include understanding the diversity of micro
and macrofungi, infectious microbes and fungal
secondary metabolites. Dr. Gunasekaran Senthilarasu
is an expert in gilled fungal identification who has worked extensively in
southern as well as western parts of India including forests of Western and
Eastern Ghats. Presently he is working on cultivation of white button
mushrooms.
Author contributions: VK—carried out field trips to
various places in Puducherry to record gilled fungi. He did the major part of
morphological and microscopic characterization of gilled fungi and wrote the
manuscript. SC—Ph.D. scholar carrying
out research work under the supervision of Dr. Vadivelu
Kumaresan helped in sampling gilled fungi and
carrying out part of microscopic analysis.
TSM—sequenced the ITS region of three gilled fungi and carried out
phylogenetic analysis.
SG—assisted in identifying and
describing some of the species of agarics mentioned in the present study.
Acknowledgements: VK thanks Dr.
M. Sangararadje, Director, Dr.
B.K. Nayak, Head of the Department of Botany, KMGIPSR, Puducherry for
facilities and encouragement, and UGC SERO (MRP-2192/06; MRP-6365/16) for
financial assistance.
Abstract: Thirty-three species of gilled
fungi belonging to 23 genera and 14 families were recorded from Puducherry,
southern India. Agaricaceae were represented
by eight species, followed by Psathyrellaceae
(5), Lyophyllaceae & Marasmiaceae
(3 each), Hymenogastraceae, Pleurotaceae, Pluteaceae,
& Polyporaceae (2 each), and Biannulariaceae, Bolbitiaceae,
Omphalotaceae, Schizophyllaceae,
Strophariaceae, & Tricholomataceae
(1 each). Fourteen species of agarics are new reports from Puducherry. Chlorophyllum rhacodes,
Lactocollybia epia,
Leucoagaricus meleagris,
and Schizophyllum commune were
widely distributed. Phylogenetic relationships of the abundant species C. rhacodes, L. epia, and
L. meleagris were inferred by maximum
likelihood method.
Keywords: Agarics, Agaricaceae,
mushrooms, phylogeny, southern India, taxonomy.
INTRODUCTION
Gilled fungi belonging to Agaricales Underw.
constitute ~10% of fungal species described so far (Kirk et al. 2008). It has
been assumed that India hosts one-third of the global fungal taxa (Manoharachary et al. 2005) and hence there is an urgent
need to document fungi in the unexplored parts of this country covering all
possible habitats and seasonal variations. This will help in maintaining the
germplasm of these important fungi, as well as to screen these macrofungi for their unique and versatile metabolic
potential.
Gilled fungi in Puducherry have
not been extensively studied. Studies on the diversity of macrofungi
in adjacent areas are by Mani & Kumaresan
(2009a,b). Thirty species of white-spored agarics
have been reported from Puducherry (Kumaresan et al.
2011), although their identity was not confirmed by phylogenetic inferences.
With the rapid deterioration of natural habitats due to human activity, it has
become imperative to record these fungi before they become extinct. The study
becomes even more interesting considering the fact that these basidiomata are ephemeral, especially the gilled fungi.
Moreover, scientists have taken recourse to molecular techniques for
identification of these poorly-studied organisms. Many Indian species are
called after their North American or European lookalikes (Cannon & Kirk
2007). Sequencing the internal transcribed spacer region for as many fungi as
possible from different regions will help immensely in creating or adding to
the existing sequence database, to resolve the identities of species complexes
and uncover new taxa.
MATERIALS AND METHODS
Basidiomata were sampled during the rainy
season of 2007–2009 and 2016–2019 from different places in Puducherry, located
160 km south of Chennai on the southeastern coast of
India. The area has a tropical climate and receives a mean annual rainfall of
around 126 cm during the north-east monsoon in the months of October–December.
During collection, photographs of fresh specimens were taken and morphological
characters of fresh basidiomata such as colour (Kornerup & Wanscher 1978),
size, and gill attachment were recorded in the field (Senthilarasu
& Kumaresan 2018). Dried basidiomata
were sealed in zip lock polythene covers after labeling
for further microscopic studies. Samples are maintained in the mushroom
herbarium collection in the Department of Botany, Kanchi
Mamunivar Government Institute for Postgraduate
Studies and Research, Puducherry, India.
Microscopic examination
Thin hand-made sections
of the pileus and gills were
taken and revived in 5–10 %
KOH and stained with phloxine (1 %). Microscopic features were
recorded following Largent (1977). Approximately, 30 basidiospores sections
were measured, excluding the apiculus. The spore
quotient (Q) was obtained by dividing the mean length by the mean width in
profile view.
DNA extraction and PCR
amplification
Few nuclear ribosomal internal
transcribed spacer sequences are available for a majority of the species
observed here, thus we isolated whole genomic DNA and amplified the ITS
sequence to compare it with available sequences in the NCBI database.
The pure fungal
culture of Leucoagaricus meleagris was inoculated
onto potato dextrose agar and grown
for 10 days at 26 °C, and the mycelia
were processed for genomic DNA isolation (Paranetharan et al.
2018). Dried basidiomata of
Chlorophyllum rhacodes and Lactocollybia
epia were processed
for genomic DNA isolation following the method of Gardes & Bruns
(1993). Using the fungal specific primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS4B (CAGGAGACTTGTACACGGTCCAG) (Gardes & Bruns
1993), a PCR reaction was performed
to amplify the internal transcribed
spacer (ITS) region. The
PCR mix consisted of PCR buffer, forward and reverse primers (10 μM each), dNTPs (4 mM), Taq Polymerase (1 U), DMSO
(1 %), MgCl2 (25 mM) and
genomic DNA (10–25 ng).
The PCR amplification was
performed as follows: 95 ºC for 10 min, 30 cycles of 95 ºC for 30 s, 55 ºC for
30 s and 72 ºC for 60 s; and 72 ºC for 10 min. The PCR products were purified
and sequenced using ABI 3130 genetic analyzer using
primers ITS1F and ITS4B.
Phylogenetic analyses
Sequences were compared using
NCBI Blast. Sequences with significant matches were selected and aligned using ClustalW (Thompson et al. 1994), checked visually and
edited as required, and evolutionary trees were inferred using the maximum likelihood
approach (Kimura 1980) using MEGA v6.06 (Tamura et al. 2013). Bootstrap
analysis (1,000 replicates) was performed to calculate the branch support (Felsenstein 1985).
RESULTS
A total of 33 species of gilled
fungi from 23 genera in 14 families were recorded from Puducherry. Of these,
eight species from four genera belonged to Agaricaceae,
constituting the dominant family among the 14 agaric families. Psathyrellaceae was represented by five
species from three genera, Lyophyllaceae by
three species from one genus and Marasmiaceae
by three species from three genera, and Hymenogastraceae,
Pleurotaceae, Pluteaceae,
and Polyporaceae by two species each (Table 1,
Images 1–3).
Taxonomy
Agaricus endoxanthus Berk. & Broome, J.
Linn. Soc., Bot. 11(no. 56): 548 (1871).
Pileus 40–90 mm diam., convex to
plano-convex with broad umbo, dark brown (6E8) to henna brown (7E8) at disc,
fading towards margin, pileus easily peeling off, surface dry, appressed
fibrillose, margin decurved, entire. Lamellae free, crowded, reddish-brown
(8D6), edge smooth. Stipe 45–100 × 5–13 mm, central, terete, broadened towards
base, white, greyish-brown (5D3) near base, fleshy fibrous, hollow, surface
smooth. Annulus superior, membranous, large. Basidiospores 4.5–6.0 × 3–4.5 µm,
Q= 1.46, ovoid to ellipsoid, brown, thick-walled.
On ground, in groups. (PY096).
Agaricus trisulphuratus Berk., Ann. Mag. nat.
Hist., Ser. 5 15: 386 (1885).
Pileus 20–30 mm diam., globoso-campanulate to convex, surface with cadmium orange
(5A8) to salmon orange (6C4) with thick pulverulent veil, later fading away,
margin appendiculate. Lamellae free, dark henna brown (7E8), crowded. Stipe
25–45 × 2–4 mm, terete, equal, surface below the annulus concolorous
with the pileus and covered by pulverulent veil. Annulus superior, fugacious.
Basidiospores 4.5–6.5 × 3–4 µm, Q= 1.53, ovoid to ellipsoid, brown,
thick-walled.
On ground, solitary. (PY109).
Agrocybe manihotis Pegler, Kew
Bull. 21(3): 508 (1968).
Pileus 30 mm diam., convex,
greyish–orange (5B3), smooth, margin decurved, entire. Lamellae adnexed, brownish grey (5C2), crowded. Stipe 45 × 5 mm,
central, concolorous with the pileus, cartilagenous, smooth. Spore-print brown. Basidiospores
10.5–12 × 6.5–7.5 μm, Q= 1.61, ellipsoid,
thick-walled with truncated germ pore, brown. Pleurocystidia pyriform, 32–45 ×
16–20 µm, Cheilocystidia broadly clavate to cylindric, 24–30 × 8–10 µm.
On ground along the grass,
solitary. (PY1746).
Coprinopsis lagopus (Fr.) Redhead, Vilgalys & Moncalvo, in
Redhead, Vilgalys, Moncalvo,
Johnson & Hopple, Taxon 50(1): 229 (2001).
Pileus 30–45 mm diam.,
plano-convex to plane, initially yellowish-brown (5D8) at the disc, becoming
brown (6E8), brownish-orange (5C5, 5C4) towards margin, surface dry, margin
plane, crenate, plicate-striate. Lamellae adnate, subdistant,
width 3 mm, teak brown (6F5), edge smooth. Stipe 30–55 × 2–4 mm, central,
terete, with slightly bulbous base (10 mm diam.), white, surface with
striations and superficial pruinose scales, cartilagenous,
hollow, small collar like ring at the base. Rhizomorphs present. Spore-print
black. Basidiospores 9.5–12 × 5.5–7 µm, Q= 1.78, ellipsoid to
elongate-ellipsoid, truncated by apical germ-pore, black, smooth.
Scattered, on ground. (PY098).
Gymnopilus subtropicus Hesler, Mycol.
Mem. 3: 41 (1969).
Pileus 20–60 mm diam., convex to
plane, apricot yellow (5B6) fading towards the margin to butter yellow (4A5),
squamulose at the disc reddish-brown (9E8), greyish ruby (12D7) in young,
surface dry, margin decurved, entire. Lamellae adnate with decurrent tooth,
close, greyish-orange (5B4), gill edge smooth, lamellulae of 5 lengths, width 5
mm. Stipe 30–50 × 3–8 mm, terete, hollow, butter yellow (4A5), base hygrophanous to reddish-brown (9F8), fleshy fibrous,
striate due to appressed scales. Spore-print brownish-orange. Basidiospores
5.5–8 × 4–5 µm, Q = 1.51, ellipsoid, brown, verruculose.
On palm trunk, in groups.
(PY119).
Leucoagaricus meleagris (Gray)
Singer, Lilloa 22: 422 (1951) [1949].
Pileus 25–35 mm diam., convex to
expanded convex, broadly parabolic when young, dark brown (8F8) at the disc,
white towards the margin, surface pruinose, margin decurved, entire. Lamellae
free, white, crowded. Stipe 60–110 × 5–8 mm, central, terete, expanding towards
the base, fleshy fibrous, smooth, solid. Annulus superior. Spore-print white.
Basidiospores 6–8 × 5–6 µm, Q= 1.53, broadly ellipsoid to ellipsoid, slightly
truncated with germ-pore, hyaline, dextrinoid with a thickened wall, guttulate.
Pleurocystidia absent. Chielocystidia 25–45 × 10–15
µm ellipsoid to short cylindric with pronounced mucronate apex.
On decaying wood, in groups and
scattered. (PY19111).
Macrocybe lobayensis (R. Heim) Pegler &
Lodge, in Pegler, Lodge & Nakasone, Mycologia 90(3):
498 (1998).
Pileus 50–120 mm diam., convex,
white, plane, dry, margin decurved, entire. Lamellae adnate, whitish to cream,
crowded. Stipe 40–100 × 15–35 mm, central, white, fleshy fibrous, smooth,
solid. Spore-print white. Basidiospores 4–6 × 3–4.5 µm, Q = 1.32, broadly
ellipsoid to ellipsoid, thin-walled, hyaline.
On ground, on soil root
interface, solitary. (PY19126).
Marasmiellus confluens (Pers.) J.S. Oliveira, in
Oliveira, Vargas-Isla, Cabral, Rodrigues & Ishikawa, Mycol. Progr. 18(5): 734 (2019).
Pileus 15–25 mm diam., convex to
plane, dry, reddish brown (9E8) at the disc, brown (6D8) towards the margin,
margin decurved, striate. Lamellae adnexed, white to
yellowish-white (1A2), crowded. Stipe 25–60 × 2–3 mm, central to slightly
eccentric, concolorous with the pileus, terete to
compressed. Spore-print white. Basidiospores 5–6.5 × 2–3 μm,
Q= 2.34, elongate to cylindric, nearly fusoid,
hyaline, inamyloid. Pleurocystidia absent. Chielocystidia
32–40 × 3.5–5.5 μm, cylindric to subfusoid,
flexuous, often somewhat lobed and diverticulate.
On leaf litter in groups,
scattered. (PY1931).
Panaeolus cyanescens Sacc., Syll.
fung. (Abellini) 5:
1123 (1887).
Pileus 20–35 mm diam., convex to conico-convex, disc brownish-grey (5C3), yellowish-white
(4A2) to yellowish-grey (4B2), towards margin, surface dry, smooth, becoming
bluish-green on bruising, margin decurved, entire. Lamellae adnate to adnexed, close, yellowish-brown (5D8) to raw umber (5F8).
Stipe 50–60 × 2–3 mm, terete, equal, yellowish white (4A2) to yellowish-grey
(4B2), cartilaginous, hollow, surface superficially pruinose, bluish-green on
bruising. Basidiospores 11.5–14 × 7–8.5 µm, Q = 1.65, lenticular, limoniform in
face-view, elongate-ellipsoid in side view, blackish-brown, smooth apically
truncated by a germ-pore.
On soil and decaying litter, in
groups. (PY092).
Parasola plicatilis (Curtis) Redhead, Vilgalys & Hopple, in Redhead, Vilgalys,
Moncalvo, Johnson &
Hopple, Taxon 50(1): 235 (2001).
Pileus 20–25 mm diam.,
membranous, convex to plane, greyish-yellow (4B5) at the disc, grooves orange
white (6A2), olive brown (4D8) elsewhere, surface dry, plicate striate, margin
plane, crenate. Lamellae free, brownish grey (4D2), subdistant.
Stipe 85–100 × 1–2 mm, central, terete, white, cartilagenous,
smooth, inserted. Basidiospores 11.5–14.5 × 8.5–10.5 µm, Q= 1.47, lenticular,
ellipsoid in side view, with abaxially inclined germ-pore, black, smooth.
Solitary, on ground. (PY065).
Psathyrella candolleana (Fr.) Maire, in Maire &
Werner, Mém. Soc. Sci. Nat. Maroc. 45:
112 (1937).
Pileus 20–35 mm diam., convex to
broadly companulate, brown (6E8) to brownish-orange
(5C4), margin appendiculate. Lamellae adnexed, dark
brown (9F7), crowded. Stipe 40–70 × 3–4 mm, central, white, terete, smooth,
hollow. Spore-print dark brown. Basidiospores 6–7.5 × 3.5–4.5 µm, Q= 1.69,
ellipsoid to elongate ellipsoid, with a truncated end, smooth, dark brown.
Pleurocystidia absent. Chielocystidia 20–30 × 7–12 μm, cylindric with rounded apex.
On ground, in groups and
scattered. (PY101).
Psathyrella
glaucescens Dennis, Kew
Bull. 15(1): 128 (1961).
Pileus 10–40 mm diam., conico-convex to convex, pale orange (5A3) to
brownish-orange (6C4), margin white to light grey (1C3), surface dry, smooth,
margin appendiculate. Lamellae adnate, brownish-orange (7C4) to greyish red
(8C4). Stipe 30–70 × 2–4 mm, white, silky fibrillose, cartilaginous, hollow.
Basidiospores 6.5–8 × 4–5 µm, Q = 1.63, ellipsoid, purplish-brown, apically
truncated by a germ-pore.
On ground, in groups. (PY003).
Psathyrella obtusata (Pers.) A.H.
Sm., Contr. Univ. Mich. Herb. 5: 55 (1941).
Pileus 15–40 mm diam., convex to
broadly campanulate, cinnamon brown (6D6) at the disc, brownish-orange (6C4)
elsewhere, dry, smooth, margin decurved, plane and uplifted, striate at extreme
margin, crisped. Lamellae adnate, close, greyish-orange (6B3). Stipe 25–35 ×
1–2 mm, terete, equal, white, cartilagenous, smooth,
hollow, inserted. Basidiospores 6.5–8 × 5–6 µm, Q= 1.31, broadly ellipsoid to
ellipsoid, truncated by an apical germ pore.
On ground, in groups and
scattered. (PY108).
Termitomyces clypeatus R. Heim, Bull. Jard. bot. État Brux. 21: 207 (1951).
Pileus 40–70 mm diam., convex to
expanded convex with a spiniform perforatium,
broadly parabolic when young, surface dark brown (7F8) at the disc, fading
towards the margin, smooth, margin decurved, entire. Lamellae adnexed to free, pinkish white (8A2), crowded. Stipe 50–60
× 8–10 mm, central, terete, expanding towards the base, fleshy fibrous, smooth,
solid. Pseudorrhiza present. Spore-print pink.
Basidiospores 5–7 × 3–4 µm, Q= 1.62, ellipsoid to elongate
ellipsoid, hyaline, guttulate. Pleurocystidia pyriform. Chielocystidia
subglobose.
On soil, solitary to scattered.
(PY1878).
Phylogenetic analysis
The sequences obtained from Chlorophyllum rhacodes,
Leucoagaricus meleagris
and Lactocollybia epia
have been deposted in GenBank with the accession
numbers MT229200, MT229202, KU320581, respectively. We constructed maximum
likelihood trees to compare our sequences to understand their phylogenetic
relationship with related sequences from the database (Figures 1–3). The
phylogenetic tree generated using ITS dataset for C. rhacodes
and related species included 28 nucleotide sequences. The tree with the
highest likelihood (-2549.8398) is depicted (Figure 1). For constructing the
tree, all positions with less than 95 % site coverage were eliminated and the
final dataset included 537 positions. The ITS sequence of C. rhacodes from this study (MT229200) was placed in the
same subclade containing sequence belonging to ITS sequence of C. rhacodes isolated from Gorakhpur, India (MH820354) with
100 % support. The maximum likelihood tree generated for ITS sequence of L. meleagris and its other related species included 17
nucleotide sequences. The tree with the highest likelihood (-1609.0537) is
depicted (Figure 2). The final dataset included 604 positions after removing
all positions with less than 95 % site coverage. Our isolate (MT229202)
clustered in the same subclade with other L. meleagris
isolate (GQ249888) from Rajasthan, India with 100 % bootstrap support. For L.
epia and its related isolates, the maximum
likelihood tree generated included 20 nucleotide sequences and the tree with
the highest likelihood (-3410.7721) is shown (Figure 3). The final dataset
included 412 positions after removing all positions with less than 95 % site
coverage. Our isolate (KU320581) clustered together with L. epia (MN523272), an isolate obtained from China, and
showed 100 % bootstrap support.
DISCUSSION
Puducherry does not have any
major forest, but there are patches of tropical dry evergreen forest and small
areas of sacred groves and mangroves (Ponnuchamy et
al. 2013). Therefore, not much litter deposition occurs to create conditions
favourable for litter fungi. Studies on the occurrence of agarics in Puducherry
resulted in recording more gilled fungi from soil as substrate including A. endoxanthus, A. trisulphuratus,
C. molybdites, C. rhacodes,
L. serenus, P. cyanescens,
three species of Termitomyces, V. hypopithys, C. lagopus,
P. plicatilis, three species of Psathyrella, A. manihotis,
L. hyalodes, and M. lobayensis.
Most of the dark-spored species recorded in the
present study were reported by Natarajan & Raman (1983) in tropical dry
evergreen forest areas. This shows that forest type plays an important role in
determining agaric species composition (Küffer& Senn-Irlet 2005). The 10 dark-spored
species along with four white-spored ones recorded in
the present study are reported for the first time from Puducherry (Table 1).
Among the three species of Psathyrella sampled
in the present study, P. candolleana is known
to be widely distributed (Manjula 1983; Natarajan et al. 2005; Farook et al.
2013; Amandeep et al. 2015a). Interestingly,
a total of 53 species of Psathyrella
have been recorded from India (Amandeep et al. 2015a); however, P. glaucescens and P. obtusata
recorded in the present study have so far not been reported from southern
India. Similarly, the genus Termitomyces,
one of the mushrooms of tribal importance (Varghese et al. 2010), was
represented by three species, of which T. microcarpus
has been reported widely (Karun & Sridhar 2013).
Vellinga (2002) based on similarities in
morphology and molecular studies transferred a few species previously placed in
Macrolepiota Singer or Lepiota (Pers.) Gray, into Chlorophyllum.
Most of the Chlorophyllum species occur in
arid habitats in subtropical to tropical regions (Ge et al. 2018). In India, C.
rhacodes is known to be widely distributed and
recorded as Macrolepiota rhacodes earlier
(Manjula 1983; Amandeep et al. 2015b). We found C. rhacodes
to occur in a number of places in Puducherry and the identity of the species
was confirmed through ITS sequence analysis by constructing maximum likelihood
based phylogenetic tree (Figure 1). Interestingly, phylogenetic analysis of ITS
sequences from two species which occurred widely in Puducherry showed that L.
meleagris (Syn: Leucocoprinus meleagris)
(Figure 2) clustered with L. meleagris
reported from Rajasthan, India while L. epia (Figure
3) formed a tight cluster with L. epia
reported earlier from China.
Table 1. Gilled fungal species
recorded from Puducherry, India.
|
Family |
Genus |
Species |
|
Agaricaceae |
Agaricus |
Agaricus endoxanthus Berk. & Broome |
|
|
|
Agaricus trisulphuratus Berk. |
|
|
Chlorophyllum |
Chlorophyllum molybdites (G. Mey.) Massee* |
|
|
|
Chlorophyllum rhacodes (Vittad.) Vellinga* |
|
|
Leucoagaricus |
Leucoagaricus meleagris (Gray) Singer |
|
|
|
Leucoagaricus serenus (Fr.) Bon & Boiffard* |
|
|
Leucocoprinus |
Leucocoprinus birnbaumii (Corda) Singer* |
|
|
|
Leucocoprinus cepistipes (Sowerby) Pat.* |
|
Biannulariaceae |
Macrocybe |
Macrocybe lobayensis (R. Heim) Pegler & Lodge |
|
Bolbitiaceae |
Panaeolus |
Panaeolus cyanescens Sacc.# |
|
Hymenogastraceae |
Gymnopilus |
Gymnopilus subtropicus Hesler |
|
|
Naucoria |
Naucoria conicopapillata (Henn.) Sacc.* |
|
Lyophyllaceae |
Termitomyces |
Termitomyces clypeatus R. Heim |
|
|
|
Termitomyces microcarpus (Berk. & Broome) R. Heim* |
|
|
|
Termitomyces striatus (Beeli) R. Heim* |
|
Marasmiaceae |
Crinipellis |
Crinipellis megalospora Singer* |
|
|
Lactocollybia |
Lactocollybia epia (Berk. & Broome) Pegler*# |
|
|
Tetrapyrgos |
Tetrapyrgos nigripes (Fr.) E. Horak* |
|
Omphalotaceae |
Marasmiellus |
Marasmiellus confluens (Pers.) J.S. Oliveira |
|
Pleurotaceae |
Hohenbuehelia |
Hohenbuehelia atrocoerulea (Fr.) Singer* |
|
|
Pleurotus |
Pleurotus ostreatus (Jacq.) P. Kumm.* |
|
Pluteaceae |
Volvariella |
Volvariella hypopithys (Fr.) Shaffer* |
|
|
|
Volvariella volvacea (Bull.) Singer* |
|
Polyporaceae |
Lentinus |
Lentinus cladopus Lév.* |
|
|
|
Lentinus squarrosulus Mont.* |
|
Psathyrellaceae |
Coprinopsis |
Coprinopsis lagopus (Fr.) Redhead, Vilgalys & Moncalvo |
|
|
Parasola |
Parasola plicatilis (Curtis) Redhead, Vilgalys
& Hopple |
|
|
Psathyrella |
Psathyrella candolleana (Fr.) Maire |
|
|
|
Psathyrella glaucescens Dennis |
|
|
|
Psathyrella obtusata (Pers.) A.H. Sm. |
|
Schizophyllaceae |
Schizophyllum |
Schizophyllum commune Fr.* |
|
Strophariaceae |
Agrocybe |
Agrocybe manihotis Pegler |
|
Tricholomataceae |
Lepista |
Lepista hyalodes (Berk. & Broome) Pegler*# |
*The species have already been
recorded with brief descriptions in Kumaresan et al.
(2011). The remaining species are recorded for first time from Puducherry. #Incertae
sedis.
For figures
& images – click here
REFERENCES
Amandeep, K.,
N.S. Atri & K. Munruchi
(2015a). Psathyrella (Psathyrellaceae,
Agaricales) species collected on dung from Punjab,
India. Current Research in Environmental & Applied Mycology 5(2):
128–137. https://doi.org/10.5943/cream/5/2/6
Amandeep, K.,
N.S. Atri & K. Munruchi
(2015b). A Checklist
of Coprophilous Agarics of India. Current Research in Environmental &
Applied Mycology 5(4): 322–348. https://doi.org/10.5943/cream/5/4/3
Cannon, P.F.
& P.M. Kirk (2007). Fungal Families of the World. CABI, UK, 456pp.
Farook, V.A.,
S.S. Khan & P. Manimohan (2013). A checklist of agarics (gilled
mushrooms) of Kerala State, India. Mycosphere
4: 97–131.
Felsenstein, J. (1985). Confidence limits on
phylogenies: An approach using the bootstrap. Evolution 39: 783–791.
Gardes, M. & T.D. Bruns (1993). ITS primers with enhanced specificity for
basidiomycetes – application to the identification of mycorrhizae and rusts. Molecular
Ecology 2: 113–118.
Ge, Z.-W., A.
Jacobs, E.C. Vellinga, P. Sysouphanthong,
R. van der Walt, C. Lavorato, Y.-F. An & Z.L.
Yang (2018). A multi-gene
phylogeny of Chlorophyllum (Agaricaceae, Basidiomycota): new species, new combination
and infrageneric classification. MycoKeys 32:
65–90. https://doi.org/10.3897/mycokeys.32.23831
Karun, N.C.
& K.R. Sridhar (2013). Occurrence and distribution of Termitomyces
(Basidiomycota, Agaricales) in the Western Ghats and
on the west coast of India. Czech Mycology 65: 233–254.
Kimura, M.
(1980). A simple
method for estimating evolutionary rate of base substitutions through
comparative studies of nucleotide sequences. Journal of Molecular Evolution
16: 111–120.
Kirk, P.M.,
P.F. Cannon, D.W. Minter & J.A. Stalpers (2008). Ainsworth & Bisby’s Dictionary of the Fungi, 10th Edition. CABI,
Wallingford.
Kornerup, A. & J.H. Wanscher (1978). Methuen Handbook of Colour. 3rd edition. Eyre Methuen,
London.
Küffer N. & B. Senn-Irlet
(2005). Influence of
forest management on the species richness and composition of wood-inhabiting
basidiomycetes in Swiss forests. Biodiversity and Conservation 14:
2419–2435.
Kumaresan, V., R. Veeramohan
& T. Ganesan (2011). Diversity of white-spored agarics in
Puducherry. Journal of Mycology and Plant Pathology 41: 518–523.
Largent, D.L.
(1977). How to
identify Mushrooms to genus I: Macroscopical
Features. Mad Rivers
Press, Eureka, USA, 85pp.
Mani, S.
& V. Kumaresan (2009a). Occurrence of macrofungi on the Coromandel coast of Tamil Nadu, southern
India. Journal of Threatened Taxa 1(1): 54–57. https://doi.org/10.11609/JoTT.o1773.54-7
Mani, S.
& V. Kumaresan (2009b). Diversity and distribution of macrofungi in the man-made Pitchandikulam
Forest of Tamil Nadu, southern India. Journal of Threatened Taxa 1(6):
340–343. https://doi.org/10.11609/JoTT.o2129.340-3
Manjula, B.
(1983). A revised
list of the agaricoid and boletoid
basidiomycetes from India and Nepal. Proceedings of the Indian Academy of
Sciences (Plant Sciences) 92: 81–213.
Manoharachary, C., K. Sridhar, R. Singh, A. Adholeya, T.S. Suryanarayanan, S.
Rawat & B.N. Johri (2005). Fungal biodiversity: distribution, conservation and
prospecting of fungi from India. Current Science 89: 58–71.
Natarajan,
K., V. Kumaresan & K. Narayanan (2005). A checklist of Indian agarics
and boletes (1984–2002). Kavaka 33: 61–128.
Natarajan, K.
& N. Raman (1983). South Indian Agaricales: A preliminary study
on some dark spored species. Bibliotheca Mycologica
Vol 89. J. Cramer, Germany, 203pp.
Paranetharan, M.S., N. Thirunavukkarasu,
T. Rajamani, T.S. Murali
& T.S. Suryanarayanan (2018). Salt-tolerant chitin
and chitosan modifying enzymes from Talaromyces stipitatus, a mangrove endophyte.
Mycosphere 9: 215–226.
Ponnuchamy, R., A. Pragasam,
S. Aravajy, P. Patel, L. Das & K. Anupama (2013). A floristic study on herbs and
climbing plants at Puducherry, South India: an approach to biodiversity
conservation and regeneration through eco-restoration. Check List 9:
555–600.
Senthilarasu, G. & V. Kumaresan
(2018). Mushroom
Characterization: Part I – Illustrated Morphological Characteristics. Current
Research in Environmental & Applied Mycology 8: 501–555.
Tamura, K.,
G. Stecher, D. Peterson, A. Filipski
& S. Kumar (2013). MEGA6: Molecular Evolutionary Genetics Analysis version 6.0. Molecular
Biology and Evolution 30: 2725–2729.
Thompson,
J.D., D.G. Higgins & T.J. Gibson (1994). CLUSTAL W: improving the
sensitivity of progressive multiple sequence alignment through sequence weighting,
position-specific gap penalties and weight matrix choice. Nucleic Acids
Research 22: 4673–4680.
Varghese,
S.P., C.K. Pradeep & K.B. Vrinda
(2010). Mushrooms of
tribal importance in Wayanad area of Kerala. Journal of Mycopathological Research 48(2): 311–320.
Vellinga, E.C. (2002). New combinations in Chlorophyllum. Mycotaxon
83: 415–417.