Journal of Threatened Taxa |
www.threatenedtaxa.org | 26 August 2022 | 14(8): 21605–21611
ISSN 0974-7907 (Online) | ISSN 0974-7893
(Print)
https://doi.org/10.11609/jott.6900.14.8.21605-21611
#6900 | Received 17 November 2020 | Final
received 09 August 2022 | Finally accepted 11 August 2022
DNA barcoding of a
lesser-known catfish, Clupisoma bastari (Actinopterygii: Ailiidae)
from Deccan Peninsula, India
Boni Amin Laskar 1, Harikumar Adimalla 2, Shantanu Kundu 3, Deepa
Jaiswal 4 & Kailash
Chandra 5
1,4 Freshwater Biology
Regional Centre, Zoological Survey of India, Attapur,
Hyderabad 500032, India.
2 House No. 2-60,
Village Turkapalle, Nalgonda, Telangana 508266,
India.
3 Centre for DNA
Taxonomy, Molecular Systematics Division, Zoological Survey of India, M Block,
New Alipore, Kolkata, West Bengal 700053, India.
5 Zoological Survey of
India, Prani Vigyan Bhawan, M Block, New Alipore,
Kolkata- 700053, West Bengal, India.
1 boniamin.laskar@gmail.com
(corresponding author), 2 harikumaradimalla92@gmail.com, 3 shantanu1984@gmail.com,
4 deepajzsi@gmail.com, 5 kailash616@gmail.com
Editor: Neelesh Dahanukar,
Shiv Nadar University, Noida, India. Date
of publication: 26 August 2022 (online & print)
Citation: Laskar,
B.A., H. Adimalla, S. Kundu, D. Jaiswal & K.
Chandra (2022). DNA barcoding of a lesser-known catfish, Clupisoma bastari
(Actinopterygii: Ailiidae) from Deccan Peninsula,
India. Journal of Threatened Taxa 14(8): 21605–21611. https://doi.org/10.11609/jott.6900.14.8.21605-21611
Copyright: © Laskar et al. 2022. Creative Commons
Attribution 4.0 International License. JoTT allows unrestricted use, reproduction, and
distribution of this article in any medium by providing adequate credit to the
author(s) and the source of publication.
Funding: The research is
funded by the Core Funding of Zoological Survey of India (ZSI), Kolkata,
Ministry of Environment, Forest and Climate Change (MoEF&CC),
New Delhi.
Competing interests: The authors
declare no competing interests.
Author details: Boni Amin Laskar is currently working
as Scientist-E in High Altitude Regional Centre of Zoological Survey of India, Solan. His field of research is molecular studies &
taxonomy of freshwater fishes. He has over 20 years of research experience
including field surveys throughout various Biogeographic zones in India. Harikumar Adimalla is a
budding researcher in the field of molecular studies of freshwater fishes from
Deccan peninsular biogeographic zone. Shantanu Kundu is a molecular biologist
with over 10 years of experience including field surveys and molecular studies
of Indian fauna, especially the Himalayan and northeastern Indian region. He is
currently working as a post-doctoral fellow in the Department of Marine
Biology, Pukyong National University, Busan, South
Korea. Deepa
Jaiswal is working as Scientist-E in Freshwater Biology Regional Centre
of Zoological Survey of India, Hyderabad. Her field of specialization is
taxonomy of aquatic Insects. Kailash
Chandra is the former Director of Zoological Survey of India. He is a
renowned taxonomist in India and is a recipient of E.K. Janaki Ammal National Award on taxonomy.
Author contributions:
BAL & HA did field surveys and collected the
specimens. BAL studied the morphology and meristics
of the specimens for taxonomic identification. HA generated the DNA data. BAL
& SK did the molecular analysis. BAL, SK & DJ wrote the article. BAL & KC
reviewed the article.
Acknowledgements: We are grateful to
the Director of Zoological Survey of India, Kolkata, Dr.
Dhriti Banerjee, for her support and enthusiasm, and
for providing necessary facilities for the study. The third author (SK)
acknowledges the fellowship grant received from the Council of Scientific and
Industrial Research (CSIR) Senior Research Associateship (Scientists’ Pool
Scheme) Pool No. 9072-A.
Abstract: DNA barcoding
substantiates species identification, and simultaneously indicates the misnomer
taxa. Based on the morphological descriptions, we identified a lesser-known
catfish, Clupisoma bastari,
from Godavari River basin, and contributed novel DNA barcode data to the
GenBank. The Kimura 2 parameter genetic divergence between species, and the
neighbour-joining phylogeny clearly depicted a distinct clade of C. bastari in the studied dataset. Clupisoma
bastari maintained sufficient K2P genetic
divergence (8.3% to 11.2%) with other congeners, and branched as a
sister-species of C. garua. The present study
highlights possible existence of a few misnomer taxa in the GenBank. We
encourage further extensive sampling of different congeners of Clupisoma from a wide range of habitats to
explore the species diversity and phylogenetic relationship.
Keywords: Eastern Ghats,
ichthyology, species identification, taxanomy.
Introduction
The genus Clupisoma Swainson is
classified under a newly set up family Ailiidae, and
is currently comprised of nine valid species (Wang et al. 2016; Fricke 2020),
distributed across Salween basin in Yunnan, China, to westward Indus basin in
Pakistan (Jayaram 1977; Ferraris 2004; Chen et al. 2005). Among them, four
species are distributed in Indus, Ganges, Brahmaputra, and Godavari basins, in
India. Clupisoma bastari
Datta & Karmakar (1980)
was described from Indravathi River, a tributary of
river Godavari in peninsular India. Due to its limited distribution, the
species has been poorly studied, and it was once categorized as ‘Endangered’ (Molur & Walker 1998). The species is currently
categorized as ‘Data Deficient’ in the International Union for Conservation of
Nature Red List and referred to as extant resident of the State Chattisgarh in central India (Dahanukar
2011). Apart from a few studies on the length-weight relationship, and food and
feeding habit, on a collection of specimens during 1997–98 from upper Godavari
basin (Bhowate & Mulgir
2006, 2009), the species was sometime reported from Ravi Shankar Sagar reservoir and from Tapti river in the central
Mahanadi basin (Desai & Srivastava 2004; Siddiqui & Pervin
2017). C. bastari was not
enlisted in the updated checklist of ichthyofauna of Eastern Ghats as well as
studies from other localities within the Deccan Peninsula (Barman 1993; Devi
& Indra 2003; Johnson et al. 2012; Laxammappa
& Bakshi 2016). C. bastari
has been presumably overlooked in the earlier studies due to misidentification
of Clupisoma congeners in India.
Besides traditional
taxonomy, the molecular data is effectively evidenced to identify and
distinguish freshwater fishes around the world (Hubert et al. 2008; Ward et al.
2009; Steinke et al. 2009; April et al. 2011; Collins et al. 2012). Several
small to large-scale attempts have been endeavored to
build-up the DNA barcode reference library of freshwater fishes from India and neighboring countries, aiming to quick and reliable species
identification and to illuminate species diversity from different biogeographic
zones (Khedkar et al. 2014; Chen et al. 2015; Barman
et al. 2018; Laskar et al. 2018; Kundu et al. 2019;
Rahman et al. 2019). Although, the GenBank database holds several publicly
available DNA barcode sequences of Clupisoma
species, the genetic information on C. bastari
was lacking. We studied C. bastari
from central Godavari basin surrounding its type locality and generated the
DNA barcode data to fill the gap of knowledge.
Materials and methods
Specimens of Clupisoma garua were
collected from Mahanadi river basin, Odisha; and C. bastari from two different localities in Godavari River
basin in Deccan Peninsula, India (Figure 1). The specimens are registered in
the National Zoological Collections of Zoological Survey of India, Hyderabad. Clupisoma garua,
FBRC/ZSI/F2445, ex 1, 190 mm SL; Odisha, Ib
river, near Jharsuguda-Raigarh road, about 30 Km from
Hirakud reservoir, 21.866N 83.951E, 28 August
2017; C. bastari, FBRC/ZSI/F2410,
ex 1, 185 mm SL; Telangana, Sriram Sagar Reservoir,
18.99N 78.31E, 13 June 2017; and C. bastari,
FBRC/ZSI/F3461, ex 1, 122 mm SL, Telangana, Godavari-Sabri confluence, near Konavaram bridge, 17.56N 81.26E, 24 November 2019.
The genomic DNA was
extracted through QIAamp DNA Mini Kit (Qiagen,
Valencia, CA) following manufacturer’s procedures. The published primer pair
(Ward et al. 2005): FishF1-5′TCAACCAACCACAAAGACATTGGCAC3′ and
FishR1-5′TAGACTTCTGGGTGGCCAAAGAATCA3′ was used to amplify the partial
cytochrome oxidase subunit I gene (mtCOI) in a Veriti® Thermal Cycler (Applied Bio systems, Foster
City, CA). The 30 µl PCR mixture contains 10 pmol of
each primer, 100 ng of DNA template, 1 × PCR buffer, 1.0–1.5 mM of MgCl2, 0.25 mM of each
dNTPs, and 1U of Taq polymerase (Takara BIO Inc.,
Japan). The thermal profile comprised of an initial step of 2 min at 95 °C
followed by 35 cycles of 0.5 min at 94 °C, 0.5 min at 54 °C, and 1 min at
72 °C, followed in turn by 10 min at 72 °C and subsequent hold at 4°C. The PCR
products were further purified using QIAquickR Gel
extraction Kit (Qiagen, Valencia, CA). The cycle sequencing and Sanger
sequencing was executed commercially. Both forward and reverse chromatograms
were checked through SeqScanner V1.0 (Applied
Biosystems Inc., CA, USA), nucleotide BLAST (https://blast.ncbi.nlm.nih.gov/),
and ORF finder (https://www.ncbi.nlm.nih.gov/orffinder/) to trim the low
quality reads and gaps. The COI barcode sequences of C. bastari and C. garua
generated in this study are available in GenBank and the accession numbers are
reflected in the phylogenetic tree. Further, the sequences of nominal Clupisoma congeners were downloaded
from the GenBank database to form a combined dataset for estimating genetic
distance and phylogenetic analysis. However, a few sequences of nominal C.
garua (accession numbers: KX455904, FJ459470,
FJ459471, and MN259175) were not included in the final dataset assuming that
these are probably conspecifics of Silonia silondia as observed in test of phylogeny covering all
the available sequences of the family Ailiidae and Scilbeidae from NCBI database. The sequence of Ailia coila
(MN083152) was used as an out-group in the phylogenetic analysis of the Clupisoma congeners. The dataset was aligned using ClustalX (Thompson et al. 1997) and Kimura 2 parameter
(K2P) genetic distances and neighbor-joining
phylogeny using K2P were generated by using MEGAX (Kumar et al. 2018).
Results
The specimens were
morphologically identified following the taxonomic descriptions (Hamilton 1822;
Hora 1937; Datta & Karmakar
1980; Ferraris 2004). Clupisoma bastari (Image 1) is identified based on the
combination of following morphological characters: body elongate and
compressed, abdominal edge keeled from vent to thorax, snout bluntly pointed,
eyes large, visible from ventral surface, mouth subterminal, cresentic, upper jaw slightly longer, teeth villiform in
bands in both jaws, vomero-palatine band interrupted
in middle. Median longitudinal groove on upper surface of head extends to hind
border of eye. Barbels four pairs, maxillary barbels extending to anal fin base, inner mandibular barbels longer than outer mandibular barbels,
both the mandibular barbels are longer than head,
nasal barbels extend to posterior edge of eye. Rayed
dorsal-fin inserted above middle of pectoral-fin, dorsal-fin with a strong
spine serrated internally, adipose dorsal-fin above the last quarter of
anal-fin base, pectoral-fin with a strong spine serrated internally, pelvic-fin
ends before anal opening, caudal-fin deeply forked.
Although, the length
of maxillary barbel and the extend of keel in
abdominal edge place C. bastari in
between C. garua (Hamilton,
1822) and C. prateri (Hora, 1937), but it is
sufficiently distinct from them by the combination of other morphological
characters, such as lengths of pectoral fins and maxillary barbels.
Further, in C. garua, adipose fin is
absent and anal fin is short while in the Burmese species C. prateri, the branched anal fin rays counts in the
range from 37 to 42 (modally 39) and the abdominal edge keeled throughout.
However, in C. prateri, maxillary barbel extends up to middle of pelvic, mandibular barbel reaches base of pectoral, and pectoral reaches
pelvic origin. These morphological differences are sometime indiscernible
leading to incorrect identification among the three species.
The generated DNA
barcodes of C. bastari (accession
numbers: MF601325 and MT821302) maintained 9.9% K2P genetic divergence with our
generated sequence of C. garua (accession
number: MG572775) as well as with the database sequences of topotypic
C. garua, and similarly with the other
congeners (Table 1). The NJ phylogeny revealed the occurrence of four species
clades with a distinct lineage of C. bastari
(Clade-2) in the studied dataset (Figure 2). The Clade-1 is unexpectedly
included by sequences of three following nominal taxa maintaining very low
genetic divergence of 0.6%: our own studied C. garua
(Mahanadi River basin), C. garua (Barak River
basin, Ganges River basin, and Narmada River basin in India; Surma River basin, Meghna River basin, and Sundarbans in Bangladesh),
C. prateri (Narmada River basin in India, and Surma River basin and Sundarbans in Bangladesh), and C.
longianalis (Huang, 1981) (Mekong River near its
type locality).
The present genetic
analysis evidenced the presence of misnomer taxa named as C. prateri and C. longianalis
nested in C. garua clade-1 (Figure
2). The studied species, C. bastari (Clade-2)
along with one database sequence (Clupisoma
sp. JX260854 generated from Godavari River) showed 0.2% intra-species genetic
divergence and maintained 9.9% K2P genetic divergence with C. garua (Clade-1) and 10.0–11.2% with other two clades
(Clade-3 and Clade-4) (Table 1). The Clade-3 is comprising of three database
sequences of C. sinense from Mekong
basin. The Clade-4 is comprising of two database sequences (Accessions:
MN178280 and KY909150) with the name C. garua,
but the clade is distinct from the topotypic C.
garua (clade-1) and also maintains sufficient
species level genetic distance with the congeners. In NCBI database, no
sequence is available with the name C. Montana. However, the two
sequences (MN178280 from Ghaghara River, Nepal; KY909150 from Ranganadi River, Arunachal Pradesh, India) are presumed as
possible lineage of C. montana and tentatively
assigned as C. Montana having type locality in Teesta River,
India.
The BIN list in
public data portal in Boldsystem revealed four
distinct BINs in the Clupisoma. The species, C.
bastari, was assigned a distinct BIN:
BOLD:ABY1142. There are two different BINs for the sequences named as C.
garua. A few of the sequences named as C. prateri are included in one of the BINs of C. garua. Similarly, two sequences included in one of
the BINs of C. garua appear as a
misidentified case which we tentatively assigned as C. Montana.
Discussion
Among all the
congeners, C. garua is a widely
distributed species and listed frequently in several freshwater fish
inventories (Gupta & Banerjee 2016; Bhakta & Sonia 2020). However, the
report of occurrence of C. garua from Godavari
basin is doubtful. One of the sequences of C. garua
from Barak River basin (JN628921) in this clade-1 was also morphologically
identified as C. garua by the first
author in previous studies (Bhattacharjee et al. 2012). Further, the sequences
(JX983272 to JX983278) named as C. prateri
sampled from Narmada basin have been corrected as C. garua
(Khedkar et al. 2014). Nevertheless, C. prateri was originally described from Irrawady drainage in Myanmar. Later on, another species
C. roosae Ferraris (2004) was
described from the same river. But, no sequence information is available for C.
roosae. Although, plethora of studies suggest
the occurrence of C. garua in south
Indian waters, but, no such specimen was observed in the Krishna River in
Andhra Pradesh and the Godavari River in Telangana. We suggest further
examination of C. garua using molecular
data from southern Indian waters.
Based on the
morphological characters, C. montana
and C. naziri Mirza & Awan (1973)
(type locality Indus River basin Pakistan) were placed into one group having
abdominal edge rounded while that is keeled in C. garua,
C. bastari, and C. prateri (Datta
& Karmakar 1980). Clupisoma
montana is also a poorly known species and has
been occasionally reported from central India (Johnson et al. 2012), Bihar (Gunasekar & Isaac 2017) and part of lower Brahmaputra
basin in Assam (Saha & Bordoloi
2009). Besides, a few haematological and biological studies on C. Montana
are also available (Grover et al. 1999). Therefore, further DNA barcode
data of C. montana from its type
locality will ease to understand the phylogeny and distribution of this species
in a precise manner.
DNA barcoding uses
genetic information of an agreed upon segment of mtCOI
gene for efficient discrimination of animal taxa at species level (Hebert et
al. 2003). With the application of this advanced technique, taxonomic
comparison becomes an easy task (Tautz et al. 2002).
This tool also effectively utilized for below the species level identification,
cryptic species or species-complex detection through intra- and inter-species
barcode gap assessment (Blaxter 2003). With the
improving trends in DNA barcoding, the ichthyofaunal diversity has been
largely explored throughout the world including India. As of now a total of
11,613 DNA barcode sequences of class Actinopterygii have been generated from
different biogeographic realms in India and deposited in the Barcode of Life
data system (Accessed on 3 August 2020), and even GenBank consisted
more than that. The present study contributes novel barcode sequences of
morphologically identified lesser-known C. bastari
to the GenBank database.
Data availability
The data that support
the findings of this study are openly available at NCBI GenBank database at
(https://www.ncbi.nlm.nih.gov) with the accession number (MF601325, MG572775,
and MT821302), which permits unrestricted use, distribution, and
reproduction in any medium, provided the original work is properly cited.
Table 1. The
estimated inter- and intra-species genetic divergence in Clupisoma
congeners.
Grouped Taxa/Clades |
Between groups K2P
(%) |
Within group K2P
(%) |
||
1 |
2 |
3 |
|
|
1. C. garua (clade-1) |
|
|
|
0.65 |
2. C. bastari (clade-2) |
10.1 |
|
|
0.19 |
3. C. sinense (clade-3) |
10.4 |
10.3 |
|
1.20 |
4. C. montana (clade-4) |
10.9 |
11.2 |
10.0 |
0.16 |
For figures &
image - - click here for full PDF
References
April, J., R.L. Mayden, R.H.
Hanner & L. Bernatchez (2011). Genetic calibration
of species diversity among North America’s freshwater fishes. Proceedings of
the National Academy of Sciences 108: 10602–10607.
Armstrong, K.F. & S.L. Ball (2005). DNA barcodes for
biosecurity: invasive species identification. Philosophical Transactions of
the Royal Society B Biological 360: 1813–1823.
Barman, A.S., M. Singh, S.K. Singh, H. Saha, Y.J. Singh, M. Laishram
& P.K. Pandey (2018). DNA Barcoding of Freshwater Fishes of
Indo-Myanmar Biodiversity Hotspot. Scientific Reports 8: 8579.
Barman, R.P. (1993). Freshwater fishes.
State Fauna Series 5, Fauna of Andhra
Pradesh Pt-I: 334 pp.
Bergsten, J., D.T. Bilton, T.
Fujisawa, M. Elliott, M.T. Monaghan, M. Balke,
L. Hendrich, J. Geijer, J.
Herrmann, G.N. Foster, I. Ribera, A.N. Nilsson, T.G. Barraclough
& A.P. Vogler (2012). The effect of geographical scale of sampling on
DNA barcoding. Systematic Biology 61: 851–869.
Bhakta, D. & Sonia (2020). Review on Clupisoma garua (Hamilton,
1822), an inhabitant species in inland open waters of India. Innovative
Farming 5(1): 25–29.
Bhattacharjee, M.J., B.A. Laskar,
B. Dhar & S.K. Ghosh (2012). Identification and Re-Evaluation
of Freshwater Catfishes through DNA Barcoding. PLoS
One 7: e49950.
Bhowate, C.S. & M.T. Mulgir (2006). Length-Weight relationship in
the catfish Clupisoma bastari,
pp. 27–35. In: Pandey, B.N. (ed.). Ecology and Environment.
APH Publishing Corporation, 384 pp.
Bhowate, C.S., M.T. Mulgir & A.N. Kulkarni (2009). Food and feeding
habits of Clupisoma bastari
Datta and Karmakar
inhibiting Godavari River, Nanded, Maharashtra. Bioinfolet
6(1): 55–56.
Blaxter, M. (2003). Molecular
systematics: counting angels with DNA. Nature 421: 122–124.
Chen, W., X. Ma Shen, Y.Y. Mao & S. He (2015). The fish diversity
in the upper reaches of the Salween River, Nujiang
River, revealed by DNA barcoding. Scientific Reports 5: 17437.
Chen, X.Y., C.J. Ferraris & J.X. Yang (2005). A new species of
catfish of the genus Clupisoma (Siluriformes: Schilbeidae) from
the Salween River, Yunnan, China. Copeia 2005:
566–570.
Collins, R.A. & R.H. Cruickshank (2013). The seven deadly
sins of DNA barcoding. Molecular Ecology Resources 13: 969–975.
Collins, R.A., K.F. Armstrong, R. Meier, Y. Yi, S.D.
Brown, R.H. Cruickshank, S. Keeling & C. Johnston (2012). Barcoding and border
biosecurity: identifying cyprinid fishes in the aquarium trade. PLoSOne 7: e28381.
Dahanukar, N. (2011). Clupisoma
bastari. The IUCN Red List of Threatened
Species 2011: e.T168352A6481275. Accessed on 4th August 2020. https://doi.org/10.2305/IUCN.UK.2011-1.RLTS.T168352A6481275.en
Datta, A.K. & A.K. Karmakar (1980). Clupisoma
bastari sp. nov.
(Pisces: Schilbeidae) from Bastar,
Madhya Pradesh, India. Bulletin, Zoological Survey of India
2(2&3): 193–196.
Desai, V.R. & N.P. Shrivastava (2004). Ecology and
fisheries of Ravishankar Sagar
Reservoir. Central Inland Fisheries Research Institute (CIFRI) 126:
1–37.
DeSalle, R. & P.
Goldstein (2019). Review and Interpretation of Trends in DNA
Barcoding. Frontiers in Ecology and Evolution 7: 302.
Ferraris, C.J. (2004). A new species of the
Asian schilbid catfish genus Clupisoma
from Myanmar, with a redescription of Clupisoma prateri
Hora (Osteichthyes: Siluriformes: Schilbidae).
Zootaxa 437: 1–10.
Fricke, R.
(2020). Eschmeyer’s catalog of fishes:
References. http://researcharchive.calacademy.org/research/ichthyology/catalog/fishcatmain.asp.
Accessed on 4th August 2020.
Grover, S.P., J.V.S. Rauthan
& G. Rawat (1999). Haematological studies on a hill stream fish Clupisoma montana
(Hora) of Garhwal Himalaya. Indian Journal of
Physical and Natural Sciences Section A 15: 4–6.
Gunasekar, A. & S.S. Isaac
(2017). The Biodiversity of fish fauna in Indrapuri
Dam Rohtas district, Bihar (India). International
Journal of Fisheries and Aquatic Studies 5(2): 416–419.
Gupta, S. & S. Banerjee (2016). A note on Clupisoma garua
(Hamilton, 1822), a freshwater catfish of Indian subcontinent (Teleostei: Siluriformes). Iranian
Journal of Ichthyology 3: 150–154.
Hamilton, F. (1822). An account of the
fishes of the River Ganges and its branches. George Ramsay and Co., London, vii
+ 405 pp., 39 pls. https://doi.org/10.5962/bhl.title.59540
Hubbs, C.L. & K.F. Lagler
(1947). Fishes of the Great Lakes Region. Cranbook
Institute Science Bulletin 26: 1–186.
Hebert, P.D.N., A. Cywinska,
L. Shelley & J.R.B. de Waard (2003). Biological
identifications through DNA barcodes. Proc. R. Soc. Lond.
B Biol. Sci. 270: 313-321.
Hora, S.L. (1937). The game fishes of
India. III “garua bachcha
or gaurchcha”, Clupisoma
garua (Hamilton) and two allied species. Journal
of the Bombay Natural History Society 39: 659–678.
Huang, S.Y. (1981). On two new species
of the catfish genus Platytropius Hora
from Yunnan, China. Acta Zootaxonomica Sinica 6 (4): 437–440.
Hubert, N., R. Hanner, E. Holm, N.E. Mandrak, E. Taylor, M. Burridge, D. Watkinson, P. Dumont,
A. Curry, P. Bentzen, J. Zhang, J. April & L. Bernatchez (2008). Identifying Canadian
Freshwater Fishes through DNA Barcodes. PLoSOne
3: e2490.
Jayaram, K.C. (1977). Aid to the
identification of siluroid fishes of India, Burma,
Sri Lanka, Pakistan and Bangladesh. 2. Siluridae, Schilbeidae, Pangasidae, Amblycipitidae, Akysidae. Records
of the Zoological Survey of India, Miscellaneous Publication, Occassional Paper 10: 1-33.
Johnson, J.A., R. Parmar, K. Ramesh, S. Sen & M. Sreenivasa (2012). Fish diversity and
assemblage structure in Ken River of Panna landscape, central India. Journal
of Threatened Taxa 4(13): 3161-3172. https://doi.org/10.11609/JoTT.o3024.3161-72
Khedkar, G.D., R. Jamdade, S. Naik, L. David & D. Haymer
(2014). DNA barcodes for the fishes of the Narmada, one of
India’s longest rivers. PLoSOne 9: e101460.
Kumar, S., G. Stecher, M.
Li, C. Knyaz & K. Tamura (2018). MEGA X: Molecular
Evolutionary Genetics Analysis across computing platforms. Molecular Biology
and Evolution 35: 1547–1549.
Kundu, S., K. Chandra, K. Tyagi, A. Pakrashi & V. Kumar (2019). DNA barcoding of
freshwater fishes from Brahmaputra River in Eastern Himalaya biodiversity
hotspot. Mitochondrial DNA Part B 4: 2411–2419.
Laskar, B.A., V. Kumar, S.
Kundu, K. Tyagi & K. Chandra (2018). Taxonomic quest:
validating two mahseer fishes (Actinopterygii: Cyprinidae)
through molecular and morphological data from biodiversity hotspots in India. Hydrobiologia 815: 113–124.
Laxmappa, B. & R.R. Bakshi (2016). A Checklist of fishes of
Telangana State, India. International Journal of Fisheries and Aquatic
Studies 4(4): 35-42.
Lipscomb, D., N. Platnick
& Q. Wheeler (2003). The intellectual content of taxonomy: a comment
on DNA taxonomy. Trends in Ecology & Evolution 18: 65–66.
Meier, R., G. Zhang & F. Ali (2008). Te
use of mean instead of smallest interspecifc
distances exaggerates the size of the “barcoding gap” and leads to misidentifcation. Systematic Biology 57: 809–813.
Mirza, M.R. & M.I. Awan (1973). Two new catfishes
(Pisces, Siluriformes) from Pakistan. Biologia (Lahore) 19(1-2): 145–159.
Molur, S. & S. Walker
(eds.) (1998). Conservation assessment and management plan for
freshwater fishes of India. Workshop Report. Zoo Outreach Organization,
Coimbatore/CBGS and NBFGR, Lucknow, India, 158 pp.
Moritz, C. & C. Cicero (2004). DNA barcoding:
promise and pitfalls. PLoSBiol. 2: e354.
Rahman, M.M., M. Norén, A.R.
Mollah & S.O. Kullander
(2019). Building a DNA barcode library for the freshwater
fishes of Bangladesh. Scientific Reports 9: 9382.
Rema Devi, K. & T.J. Indra (2003). An updated checklist
of ichthyofauna of Eastern Ghats. Zoos’ Print Journal 18(4): 1067-1070.
Saha, S. & S. Bordoloi (2007). Ichthyofaunal
diversity of two beels of Goalpara
District, Assam, India. Journal of Threatened Taxa 1(4): 240–242. https://doi.org/10.11609/JoTT.o1806.240-2
Shen, Y.Y., X. Chen & R.W. Murphy (2013). Assessing DNA
barcoding as a tool for species identification and data quality control. PLoSOne 8: e57125.
Siddiqui, A. & S. Pervin
(2017). Study of ichthyofaunal diversity of Tapti River of Burhanpur District (M. P.). Life Science Bulletin
14(2): 185–188.
Steinke, D., T.S. Zemlak
& P. Hebert (2009). Barcoding Nemo: DNA-based identifications for
the ornamental fish trade. PLoSOne 4: e6300.
Stoeckle, M. (2003). Taxonomy, DNA, and
the bar code of life. Bioscience 53: 796–797.
Tautz, D., P. Arctander, A. Minelli, R.H. Thomas & A.P. Vogler
(2002). DNA points the way ahead in taxonomy. Nature
418: 479–479.
Tautz, D., P. Arctander, A. Minelli, R.H. Thomas & A.P. Vogler
(2003). A plea for DNA taxonomy. Trends in Ecology &
Evolution 18: 70–74.
Thompson, J.D., T.J. Gibson, F. Plewniak,
F. Jeanmougin & D.G. Higgins (1997). The CLUSTAL_X
windows interface: flexible strategies for multiple sequence alignment aided by
quality analysis tools. Nucleic Acids Research 25: 4876–4882.
Wang, J., B. Lu, R. Zan, J.
Chai, W. Ma, W. Jin, R. Duan,
J. Luo, R.W. Murphy, H. Xiao & Z. Chen (2016). Phylogenetic
Relationships of Five Asian Schilbid Genera Including
Clupisoma (Siluriformes:
Schilbeidae). PLoS
One 11: e0145675.
Ward, R.D., R. Hanner & P.D.N. Hebert (2009). The campaign to DNA
barcode all fishes, FISH-BOL. Journal of Fish Biology 74: 329–356.
Ward, R.D., T.S. Zemlak,
B.H. Innes, P.R. Last & P.D.N. Hebert (2005). DNA barcoding of
Australia’s fish species. Philosophical Transactions of the Royal Society B
Biological 360: 1847–1857.