Journal of Threatened Taxa |
www.threatenedtaxa.org | 26 May 2020 | 12(8): 15881–15888
ISSN 0974-7907 (Online) | ISSN 0974-7893
(Print)
doi: https://doi.org/10.11609/jott.5679.12.8.15881-15888
#5679 | Received 03 January 2020 | Final
received 13 April 2020 | Finally accepted 03 May 2020
Morphological and molecular
phylogenetic studies on Battarrea
phalloides (Agaricales): a new report to Indian mycobiota
R. Kantharaja
1 & M. Krishnappa 2
1, 2 Department of PG Studies and
Research in Botany, Kuvempu University, Jnana
Sahyadri, Shankaraghatta, Shivamogga,
Karnataka 577451, India.
1 kanthrajkanthu46@gmail.com
(corresponding author),2 krishnappam4281@yahoo.com
Abstract: The Scaly-stalked Puffball Battarrea phalloides (Dicks.) Pers. is
recorded for the first time in India.
The fungus is reported from many countries across the continents and
typically uncommon and rare in all regions.
It is Red Listed in most of the European countries and is under
assessment in IUCN Global Fungal Red List Initiative. The Indian sample of B. phalloides is
reported from Kadur Taluk of Chikkamagaluru
District, Karnataka with morpho-molecular data.
Keywords: Elaters, Morpho-molecular, nrITS, Red List, Scaly-stalked Puffball.
Editor: R.K. Verma,
Tropical Forest Research Institute, Jabalpur, India. Date
of publication: 26 May 2020 (online & print)
Citation: Kantharaja,
R. & M. Krishnappa (2020). Morphological
and molecular phylogenetic studies on Battarrea
phalloides (Agaricales): a new report to Indian mycobiota. Journal of
Threatened Taxa 12(8): 15881–15888. https://doi.org/10.11609/jott.5679.12.8.15881-15888
Copyright: © Kantharaja
& Krishnappa 2020. Creative Commons Attribution 4.0 International
License. JoTT
allows unrestricted use, reproduction, and distribution of this article in any
medium by providing adequate credit to the author(s) and the source of
publication.
Funding: Department of Science
and Technology - Science and Engineering Research Board (DST - SERB), Government of India.
Competing interests: The authors
declare no competing interests.
Author details: R. Kantharaja is a research scholar in the Department of Botany. Kuvempu University. Jnana Sahyadri. Shankaraghatta. Currently working on morpho - molecular systematics of Agaricales in Central Western Ghats
region of Karnataka.
India. Dr.
M. Krishnappa is a mycologist
and Professor in Department
of Botany. Kuvempu
University. Jnana Sahyadri.
Shankaraghatta. Whose
research mainly focuses on fungal diversity and biology, fungal
taxonomy, endophytic fungi and fungal diseases
of plants. Since 20 years he is working on macrofungi
and honored as Fellow of Mycological Society of India for the year 2014. He has over 130
research publications in different thrust areas of life science.
Author contribution: RK carried out the research work, wrote the article.
MK guided in every step and corrected mistakes in the article.
Acknowledgements: We acknowledge the support from the Department of
Botany, Kuvempu University, Shankaraghatta,
Karnataka to carry out the research and also the Department of Science and
Technology, Science and Engineering Research Board (DST-SERB), Government of
India for the financial support through a project grant (EEQ/2016/000363).
Introduction
Battarrea phalloides (Sandy Stilt Ball, Sandy Stilt Puffball,
Scaly-stalked Puffball), previously known gasteromycete
in Battarreaceae (Corda 1842), and now a distinctive
saprobic basidiomycetous agaric fungus, easily recognizable with a scaly
lacerated stem growing up to 40cm in height, forming a reddish-brown spore case
inside a thin greyish skin. It is rare,
uncommon and occurs in small scattered populations or sometimes even appears as
single basidiomata.
Battarrea phalloides is red-listed in several European countries and is one
of the non-lichenized fungi afforded legal protection by being included in
schedule 8 of the Wildlife and Countryside Act, 1981 in the United Kingdom
(Jeffries & McLain 2004). The
species is currently under assessment for addition to the IUCN: The Global
Fungal Red List Initiative (http://iucn.ekoo.se/iucn/species_view/159853).
Sixteen species have been described in the genus Battarrea Pers. since 1801 (Index Fungorum, http://www.indexfungorum.org/) and most of them
are conspecific to Battarrea phalloides. Early taxonomic discussions about the
worthiness of morphological characters for separating B. phalloides and B.
stevenii were evaluated using modern phylogenetic
approach by Martin & Johannesson (2000), Martin
et al. (2013) and Jefferies & McLain (2014), the shreds of evidence
suggest both taxa are conspecific. In
addition, Martin & Johannesson (2000) considered
spore ornamentation as a non-molecular character for lineage recognition and
depicted three main lineages phylogenetically, they have differences in their
spore ornamentation as—(a) spores with anastomosing truncate ridges, (b) finely
verrucose, and (c) finely reticulate.
The present study describes B. phalloides as a
new report to Indian mycobiota based on morphological
characters and multigene phylogenetic analysis.
Materials and Methods
The Scaly-stalked Puffball like basidiomata
of Battarrea phalloides were collected
from Aladahalli Village (13.546N & 75.875E) of Kadur Taluk (Figure 1), Western Ghats region of Karnataka
during July 2019.
Sampling and morphological characterization
The sporomas of different
stages were collected and phenotypic characters were recorded using a field key
(Atri et al. 2017).
Microscopic characters were recorded using a light microscope (Olympus
CH20i) and the sporocarps were shade-dried and stored in the Department of
Botany, Kuvempu University for further studies (Image
1). To identify the surface
ornamentation of spores, scanning electron microscopy was carried out in ZEISS
EVO CSEM.
DNA Extraction, PCR and Phylogenetic analysis
The total genomic DNA was extracted from the freshly
collected sporocarp using the CTAB method (Doyle & Doyle 1987) with
modifications. 100mg of inner stipe
tissue was directly homogenized with 500µl of 2X CTAB extraction buffer
pre-warmed to 65°C in a 1.5ml microcentrifuge tube with the help of
micro-pestle, followed by vortexing and incubated in
a water bath at 65°C for 1h. The sample
was cooled briefly before centrifugation at 13,000rpm for 30min. To the centrifugate 3µl of RNase A (20mg/ml)
was added and incubated for 10min at 37°C, followed by the addition of an equal
amount of PCI (25:24:1) with slow invert mixing. The mixture was centrifuged at 10,000rpm for
10min at room temperature and the supernatant was extracted. To precipitate the DNA 500µl of ice-cold
isopropanol was added and incubated overnight at 4°C, followed by
centrifugation at 10,000rpm for 10min at 10°C to pellet the DNA and washed
twice with 70% ethanol, drained and dissolved in 50µl of 1X TE buffer.
PCR reactions were carried out in 0.2ml PCR tubes with
50µl reaction mixture containing, 25µl double distilled water, 8µl 10X PCR
buffer A (Himedia).
2.5µl of each primer, 0.5µl of Taq DNA
polymerase (3U/µl), 1.5µl dNTP’s mixture (Himedia)
and 10µl of DNA template. The primer
pair ITS 1 and ITS 4 (White et al. 1990) for nrITS
region and LROR and LR5 (Vilgalys & Hester 1990)
for the nrLSU region were used (Table 1). The thermal profile for nrITS
amplification; 4’ 94°C, 32 cycles of 30” 94°C, 1’ 52°C, 1’ 72°C and a final
extension step of 7’ 72°C, for nrLSU 5’ 94°C, 30
cycles of 30” 94°C, 1’ 47°C, 1’ 72°C and a final extension step of 7’
72°C. The PCR products were examined on
1% Agarose gel stained with Ethidium Bromide and visualized under gel image documentation
system (BioRad) followed by cleanup
and sequencing.
The electropherograms of both forward and reverse
sequences obtained from Eurofins Genomics India Pvt.
Ltd. Bengaluru were checked and trimmed using MEGA X (Kumar et al. 2018). Consensus sequences were generated using BioEdit sequence alignment editor v.7.2.5 (Hall, CA) by Clustal W (Madeira et al. 2019). BLAST search in the GenBank (https://blast.ncbi.nlm.nih.gov/Blast.cgi)
nucleotide database to identify the related taxa by sequence similarity and
both nrITS and nrLSU
sequences were deposited to GenBank with accession numbers MN450310 and
MN700164, respectively.
Molecular phylogenetic analysis was performed by using
nrITS and nrLSU sequences
separately. Datasets of 17 nrITS sequences (Table 2) and 15 nrLSU
sequences (Table 3) including those retrieved from the NCBI GenBank are used to
assess the alignment confidence score in the GUIDANCE web server (http://guidance.tau.ac.il)
by MAFFT algorithm (Katoh et al. 2019) to construct
100 alternative guide trees. Using
GUIDANCE outputs the columns showing less than 93% confidence scores are
removed and aligned in BioEdit v.7.2.5. The alignment file obtained is further used
to analyze the maximum likelihood in RAxML GUI v.2.0.0.0 using the GTRGAMMA+I model as suggested
by jModelTest v.2.1.10 (Darriba et
al. 2012) with 1,000 bootstrap replications.
The best trees obtained are inferred by Mr. Bayes.
Results
Taxonomy
Battarrea phalloides (Dicks.) Pers.,
MycoBank No.: 159853
GenBank Accession No.: MN450310 (nrITS),
MN700164 (nrLSU).
Basionym: Lycoperdon
phalloides Dicks., Fasciculus plantarum cryptogamicarum
Britanniae 1: 24 (1785)
Etymology: The
specific epithet phalloides refers to the similarity of volva with genus
Phallus.
Basidiomata medium to large, 20–30 cm in length (Images 2 &
3). Spore case 3–5.2 cm diam. Greyish membranous skin when young, shedding
to become convex rusty brown abundant spore mass at maturity (Image 4). Stipe
10-25cm in length, 1.8–3 cm diam., light brownish, hairy to lacerated scaly,
base include underground membranous volva.
Gleba pulverulent includes capillitia and
elaters. Spores 5–7×4–6 µm, globose to
almost elliptical (Image 5), finely reticulate (Image 6), inamyloid in Melzer’s
reagent. Elaters 50–80+ µm long 4–7µm
wide, cylindrical to fusiform, annular to spiral thickenings (Image 6),
ochraceous in KOH.
Ecology:
Saprophytic, growing alone or scattered in dry sandy soil. Cited twice in July and August 2019 in Kadur Taluk (13.546N & 75.875E).
Specimens:
India, Karnataka, Chikmagaluru District, Kadur Taluk, 28 July 2019 (KUABMK-162) and 15 August 2019, Kantharaja R & Krishnappa M.
Phylogenetic Analysis
The specimen KUABMK-162 was subjected to molecular
identification initially based on sequences of the nrITS
region via. BLAST search analysis in the
GenBank database and found >99% similarity with unpublished sequences
(DQ184690, DQ184688, and DQ184687). The
maximum likelihood analysis using RAxML and MrBayes drawn by the GTRGAMMA+I model as suggested by jModelTest v.2.1.10 confirms the closest relation of newly
generated sequences with Battarrea
phalloides with 97% bootstrap support (Figure 2). Due to unavailability of nrLSU
sequences of B. phalloides the generated nrLSU
sequences were found clustered with Battarrea
lacinata (Figure 3).
Discussion
Previous reports of Battarrea
phalloides showed the species is found in arid and semi-arid habitats like
desserts and dry Savanna (Martin & Johannessen 2000; Howladar
et al. 2013; Ivancevic et al. 2016). The
present study claims that B.
phalloides is found in Chikmagalur District,
Western Ghats region of Karnataka, India.
The climatic conditions in Kadur Taluk support
the habitat preference of the species, where the average annual rainfall
(620mm) is almost similar to the dry areas.
Howladar et al. (2013), stated Battarrea phalloides is rare everywhere but
distributed worldwide, cited the reports from across continents and this report
adds another vicinity of occurrence.
Martin & Johannessen in 2000 identified three main
lineages in a phylogenetic study of B. phalloides and B. stevenii herbarium collections from various parts of
the world by considering spore ornamentation as a non-molecular character. Contrary to this, Garrido-Benevent
in 2014 tried to represent cryptic speciation and predicted the presence of
three to four putative species within the Battarrea
phalloides-stevenii complex. but, he also noted the requirement of further
data to build a consistent taxonomy. The
current taxonomic data according to Mycobank and
Index Fungorum, however, suggests B. stevenii as a synonym of B. phalloides. In our study, the SEM image of spore confirms
the presence of reticulate ornamentation which is highly similar to the
previous reports.
The nrITS sequences of
specimen KUABMK-162 (MN450310) is found clustered with specimens from Israel,
Cyprus and UK (DQ184685, DQ184687, and DQ184690) with a well-supported
bootstrap value of 97% and maximum Bayesian posterior probability value of
0.99. Based on morpho-molecular
characters the present study confirms the identity of the specimen as Battarrea phalloides and is a new record to
Indian mycobiota.
Table 1. List of primers utilized to amplify nrITS and nrLSU gene sequences.
|
|
Primer |
Sequence |
Amplifying gene |
Tm [°C] |
|
1 |
ITS 1 |
TCCGTAGGTGAACCTTGCGG |
nrITS |
60.99 |
|
2 |
ITS 4 |
TCCTCCGCTTATTGATATGC |
55.25 |
|
|
3 |
LROR |
ACCCGCTGAACTTAAGC |
nrLSU |
52.77 |
|
4 |
LR5 |
TCCTGAGGGAAACTTCG |
52.77 |
Table 2. List of species, geographic origin and
GenBank accession numbers of nrITS sequences used in
molecular phylogeny analysis.
|
|
Species |
Geographic origin and year |
GenBank accession number |
|
1 |
Battarrea phalloides |
Spain, 2013 |
HF913784 |
|
2 |
Battarrea phalloides |
Spain, 2013 |
HF913785 |
|
3 |
Battarrea phalloides |
USA, 2017 |
MF422608 |
|
4 |
Battarrea phalloides |
UK, 2005 |
DQ184685 |
|
5 |
Battarrea stevenii |
Spain, 1999 |
AF215655 |
|
6 |
Battarrea phalloides |
UK, 2005 |
DQ184690 |
|
7 |
Battarrea phalloides |
India, 2019 |
MN450310 |
|
8 |
Battarrea stevenii |
UK, 2005 |
DQ184688 |
|
9 |
Battarrea phalloides |
UK, 2005 |
DQ184687 |
|
10 |
Tolustoma calongei |
Spain, 2016 |
KU518973 |
|
11 |
Tolustoma kotlabe |
Sweden, 2005 |
DQ112629 |
|
12 |
Tolustoma obesum |
Sweden, 2016 |
KU518987 |
|
13 |
Tolustoma obesum |
Sweden, 2016 |
KU518988 |
|
14 |
Tolustoma grandisporum |
Sweden, 2016 |
KU519003 |
|
15 |
Tolustoma grandisporum |
Sweden, 2016 |
KU519006 |
|
16 |
Tolustoma grandisporum |
Sweden, 2016 |
KU519001 |
|
17 |
Lycoperdon perlatum |
China, 2007 |
EU622257 |
Table 3. List of species, geographic origin and GenBank
accession numbers of nrLSU sequences used in
molecular phylogeny analysis.
|
|
Species |
Geographic origin and year |
GenBank accession number |
|
1 |
Chlorophyllum agaricoides |
China, 2017 |
MG742020 |
|
2 |
Chlorophyllum agaricoides |
Spain, 2015 |
KR233498 |
|
3 |
Chlorophyllum agaricoides |
China, 2017 |
MG742021 |
|
4 |
Chlorophyllum agaricoides |
Spain, 2015 |
KR233494 |
|
5 |
Chlorophyllum olivieri |
China, 2017 |
MG742037 |
|
6 |
Chlorophyllum olivieri |
China, 2017 |
MG742036 |
|
7 |
Disciseda bovista |
Hungary, 2018 |
MK277947 |
|
8 |
Tolustoma fimbriatum |
Hungary, 2018 |
MK278635 |
|
9 |
Tolustoma albicans |
Hungary, 2018 |
MK278628 |
|
10 |
Tolustoma macrocephala |
USA, 2002 |
AF518663 |
|
11 |
Tolustoma simulans |
Hungary, 2018 |
MK278639 |
|
12 |
Tolustoma simulans |
Hungary, 2018 |
MK278634 |
|
13 |
Battarrea phalloides |
India, 2019 |
MN700164 |
|
14 |
Battarrea lacinata |
USA, 1999 |
AF208534 |
|
15 |
Lycoperdon ericaeum |
Japan, 2014 |
KU507401 |
For
figures & images - - click here
References
Atri, N.S., M. Kaur & S. Sharma (2017). Characterization of Lamellate Mushroom
- An Appraisal, 471–500pp. In: Satyanarayana, T., S. Deshmukh & B. Johri
(eds.) Developments in Fungal Biology and Applied Mycology. Springer,
Singapore.
Darriba, D., G.L. Taboada, R. Doallo
& D. Posada (2012). jModelTest 2: more models, new heuristics and parallel
computing. Nature Methods 9(8): 772.
Dentinger, B.T.M., S. Margaritescu
& M. Monclavo (2010). DNA Barcoding: Rapid and reliable high-throughput
methods of DNA extraction for use in barcoding and molecular systematics of
mushrooms. Molecular Biology Resources 10: 628–633.
Doyle, J.J. & J.L. Doyle (1987). A Rapid DNA Isolation Procedure for Small Quantities
of Fresh Leaf Tissue. Phytochemical Bulletin 19(1): 11–15.
Ellis, J.B. & M.B. Ellis (1990). Fungi without gills (Hymenomycetes
and Gasteromycetes): an identification handbook.
London: Chapman & Hall.
Gardes, M. & T.D. Bruns
(1993). ITS primers with enhanced
specificity for basidiomycetes – application to the identification of
mycorrhizae and rusts. Molecular Ecology 2: 113–118.
Garrido-Benavent, I. (2014). The Battarrea
phalloides-stevanii complex: multiple sources of
evidence as a strategy to unveil cryptic species within poorly characterized
taxa. Butlletí Societat
Micològica Valenciana
19: 17–35.
Guindon, S. & O. Gascuel
(2003). A simple, fast, and accurate
algorithm to estimate large phylogenies by maximum likelihood. Systematic
Biology 52: 696–704.
Hall, T.A. (1999). BioEdit: a user-friendly
biological sequence alignment editor and analysis program for Windows 95/98/NT.
Nucleic Acids Symposium Series 41: 95–98.
Howladar, S., Y.A.G. Mahmoud & A. Meriseel
(2013). Battarrea
phalloides – new for Saudi Arabia. Österreichische
Zeitschrift für Pilzkunde 22: 1–6.
Ivancevic, B. (2017). Battarrea
phalloides. In: IUCN 2019. The Global Fungal Red List Initiative. Accessed
on 23 August 2019. http://iucn.ekoo.se/iucn/species_view/159853/
Ivancevic, B., A. Mesic, Z. Tkalcec,
I. Kusan & I. Horjan
(2016). Studies on Croatian Basidiomycota
3: the first record of Battarrea phalloides
(Agaricales) with a worldwide taxonomic review of Battarrea species. Nova Hedwigia
102: 197–209.
Jacobson, K.M., P.J. Jacobson & O.K. Miller
(1999). The autecology of Battarrea stevenii
in ephemeral rivers of southwestern Africa. Mycological Research 103:
9–17.
Jeffries, P. & L. McLain (2004). Synonymy between Battarrea
phalloides and B. stevanii. English Nature
Research Reports. Number 625.
Katoh, R. & Yamada (2019). MAFFT online service: multiple sequence alignment,
interactive sequence choice and visualization. Briefings in Bioinformatics
20:1160-1166.
Kirk, P.M., P.F. Cannon, D.W. Minter & J.A. Stalpers (2008). Ainsworth & Bisby’s
Dictionary of the Fungi, 10th Ed. CAB International,
Wallingford.
Madeira, F., Y. Park, J. Lee, N. Buso,
T. Gur, N. Madhusoosanan, P. Basutkar,
A.R.N. Tivey, S.C. Potter, R.D. Finn & R. Lopez
(2019). The EMBL-EBI search and sequence
analysis tools APIs in 2019. Nucleic Acids Research 2(47): 636–641.
Martin, K.J. & P.T. Rygiewicz
(2005). Fungal-specific PCR primers
developed for analysis of the ITS region of environmental DNA extracts. BMC
Microbiology 5(28): 1–11.
Martin, M.P. & H. Johannesson
(2000). Battarrea
phalloides and B. stevanii, insight into a
long-standing taxonomic puzzle. Mycotaxon 76:
67–75.
Martín, M.P., K. Rusevska,
M. Dueñas & M. Karadelev
(2013). Battarrea
phalloides in Macedonia: genetic variability, distribution and ecology. Acta
Mycologica 48: 113–122.
Senthilarasu, G. & V. Kumaresan
(2016). Diversity of agaric mycota of Western Ghats of Karnataka, India. Current
Research in Environmental and Applied Mycology 6(2): 75–101.
Shepherd, L.D. & J.A. Cooper (2017). First record of the fungus Battarrea
phalloides (Agaricaceae) in New Zealand. New
Zealand Journal of Botany 1–6.
Swapna, S., S. Abrar & M. Krishnappa (2008). Diversity of Macrofungi in
Semi-Evergreen and Moist Deciduous Forest of Shimoga
District-Karnataka, India. The Journal of Mycology and Plant Pathology 38(1):
21–26.
Thompson, J.D., D.G. Higgins & T.J. Gibson (1994). CLUSTAL W: improving the sensitivity of progressive
multiple sequence alignment through sequence weighting, position-specific gap
penalties and weight matrix choice. Nucleic Acids Research 22(22):
4673–4680.
Uzunov, B. (2014). New Localities of Battarrea
phalloides (Basidiomycota) in Bulgaria. Annual of Sofia University “St. Kliment Ohridski”. Faculty of
Biology. Book 2 – Botany 99: 71–75.
Vilgalys, R. & M. Hester (1990). Rapid genetic identification and mapping of
enzymatically amplified ribosomal DNA from several Cryptococcus species. Journal
of Bacteriology 172: 4238–4246.
White, T.J., T. Bruns, S.
Lee & J. Taylor (1990).
Amplification and Direct Sequencing of Fungal Ribosomal RNA Genes for
Phylogenetics, pp. 315–322. In: Innis, M., D. Gelfand, J. Sninsky
& T. White. PCR Protocols. Academic Press, Inc., NewYork.